EMAIL THIS PAGE TO A FRIEND

BBS10

Bardet-Biedl syndrome 10

Synonyms: C12orf58
UniProtKB ID: Q8TAM1, Q96CW2, Q9H5D2
Gene ID:
Human(79738) Summary: This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by progressive retinal degeneration, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene is likely not a ciliary protein but rather has distant sequence homology to type II chaperonins. As a molecular chaperone, this protein may affect the folding or stability of other ciliary or basal body proteins. Inhibition of this protein's expression impairs ciliogenesis in preadipocytes. Mutations in this gene cause Bardet-Biedl syndrome type 10. [provided by RefSeq, Jan 2010]
Mouse(71769) Bardet-Biedl syndrome 10 (human)
Rat(500832) Bardet-Biedl syndrome 10
sheep(101122679) Bardet-Biedl syndrome 10
domestic guinea pig(100714699) Bardet-Biedl syndrome 10
naked mole-rat(101708171) Bardet-Biedl syndrome 10
Zebrafish(100034535) Bardet-Biedl syndrome 10
chicken(417865) Bardet-Biedl syndrome 10
domestic cat(101083862) Bardet-Biedl syndrome 10
cow(538638) Bardet-Biedl syndrome 10
dog(100688777) Bardet-Biedl syndrome 10
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024685 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024685 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024685 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024685 Rosetta Predictions human pricing
NM_001109286 Rosetta Predictions rat pricing
XM_125817 Rosetta Predictions mouse pricing
XM_917804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087200 predicted 1168
2 SASI_Hs02_00357124 predicted 1482
3 SASI_Hs01_00087202 predicted 2186
4 SASI_Hs01_00087203 predicted 2180
5 SASI_Hs01_00087204 predicted 489
6 SASI_Hs02_00357125 predicted 2231
7 SASI_Hs01_00087205 predicted 1056
8 SASI_Hs01_00087207 predicted 508
9 SASI_Hs01_00087208 predicted 2312
10 SASI_Hs01_00087209 predicted 2280
11 SASI_Hs01_00087201 predicted 2145
12 SASI_Hs01_00087206 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246924 predicted 1675
2 SASI_Rn02_00246925 predicted 985
3 SASI_Rn02_00246926 predicted 653
4 SASI_Rn02_00246927 predicted 854
5 SASI_Rn02_00246928 predicted 1693
6 SASI_Rn02_00246929 predicted 439
7 SASI_Rn02_00246930 predicted 606
8 SASI_Rn02_00246931 predicted 1862
9 SASI_Rn02_00246932 predicted 927
10 SASI_Rn02_00246933 predicted 1413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245771 predicted 1003
2 SASI_Mm02_00424114 predicted 1021
3 SASI_Mm01_00245772 predicted 2060
4 SASI_Mm01_00245773 predicted 1113
5 SASI_Mm01_00245774 predicted 1708
6 SASI_Mm01_00245775 predicted 1103
7 SASI_Mm01_00245776 predicted 1526
8 SASI_Mm01_00245777 predicted 965
9 SASI_Mm01_00245778 predicted 1872
10 SASI_Mm01_00245779 predicted 2243
11 SASI_Mm01_00245780 predicted 1630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441415 predicted 1003
2 SASI_Mm02_00441416 predicted 2065
3 SASI_Mm02_00441417 predicted 581
4 SASI_Mm02_00441418 predicted 1119
5 SASI_Mm02_00441419 predicted 1709
6 SASI_Mm02_00441420 predicted 1108
7 SASI_Mm02_00441421 predicted 1529
8 SASI_Mm02_00441422 predicted 453
9 SASI_Mm02_00441423 predicted 607
10 SASI_Mm02_00441424 predicted 1875
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024685
BBS10 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024685.2-3048s1c1
Sequence:CCGGGCCAGAGTTCCACAGTAACAACTCGAGTTGTTACTGTGGAACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024685.2-1240s1c1
Sequence:CCGGGCATTTATACCACACTCTATACTCGAGTATAGAGTGTGGTATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024685.2-2200s1c1
Sequence:CCGGCCTCAGAAAGTTCACAATCAACTCGAGTTGATTGTGAACTTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024685.3-1904s21c1
Sequence:CCGGAGATCTTGTTACATTACTATCCTCGAGGATAGTAATGTAACAAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024685.3-1103s21c1
Sequence:CCGGCTCTTATCCGGAGGATCATTGCTCGAGCAATGATCCTCCGGATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024685.3-1027s21c1
Sequence:CCGGCAACCAGATTTAGTTAGTTATCTCGAGATAACTAACTAAATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024685.3-1813s1c1
Sequence:CCGGAGCTGTAAGTTACCGAATATGCTCGAGCATATTCGGTAACTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024685.3-2118s1c1
Sequence:CCGGGGAATCAGTAATGGGTAAATACTCGAGTATTTACCCATTACTGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024685
BBS10 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024685.2-3048s1c1
Sequence:CCGGGCCAGAGTTCCACAGTAACAACTCGAGTTGTTACTGTGGAACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024685.2-1240s1c1
Sequence:CCGGGCATTTATACCACACTCTATACTCGAGTATAGAGTGTGGTATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024685.2-2200s1c1
Sequence:CCGGCCTCAGAAAGTTCACAATCAACTCGAGTTGATTGTGAACTTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024685.3-1904s21c1
Sequence:CCGGAGATCTTGTTACATTACTATCCTCGAGGATAGTAATGTAACAAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024685.3-1103s21c1
Sequence:CCGGCTCTTATCCGGAGGATCATTGCTCGAGCAATGATCCTCCGGATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024685.3-1027s21c1
Sequence:CCGGCAACCAGATTTAGTTAGTTATCTCGAGATAACTAACTAAATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024685.3-1813s1c1
Sequence:CCGGAGCTGTAAGTTACCGAATATGCTCGAGCATATTCGGTAACTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024685.3-2118s1c1
Sequence:CCGGGGAATCAGTAATGGGTAAATACTCGAGTATTTACCCATTACTGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024685
BBS10 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172913    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024685.2-3048s1c1
Sequence:CCGGGCCAGAGTTCCACAGTAACAACTCGAGTTGTTACTGTGGAACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024685.2-1240s1c1
Sequence:CCGGGCATTTATACCACACTCTATACTCGAGTATAGAGTGTGGTATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024685.2-2200s1c1
Sequence:CCGGCCTCAGAAAGTTCACAATCAACTCGAGTTGATTGTGAACTTTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024685.3-1904s21c1
Sequence:CCGGAGATCTTGTTACATTACTATCCTCGAGGATAGTAATGTAACAAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024685.3-1103s21c1
Sequence:CCGGCTCTTATCCGGAGGATCATTGCTCGAGCAATGATCCTCCGGATAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024685.3-1027s21c1
Sequence:CCGGCAACCAGATTTAGTTAGTTATCTCGAGATAACTAACTAAATCTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024685.3-1813s1c1
Sequence:CCGGAGCTGTAAGTTACCGAATATGCTCGAGCATATTCGGTAACTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024685.3-2118s1c1
Sequence:CCGGGGAATCAGTAATGGGTAAATACTCGAGTATTTACCCATTACTGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027914
BBS10 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027914.1-2238s21c1
Sequence:CCGGCAGTGGGCAAAGGCATTTAATCTCGAGATTAAATGCCTTTGCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027914.1-1177s21c1
Sequence:CCGGATGTTCATCTCGGCTTGATTACTCGAGTAATCAAGCCGAGATGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027914.1-2163s21c1
Sequence:CCGGCAAGAATCAGAAGACGAATTTCTCGAGAAATTCGTCTTCTGATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027914.1-459s21c1
Sequence:CCGGTGTATTGTAGACCGGAGTTTACTCGAGTAAACTCCGGTCTACAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027914.1-1291s21c1
Sequence:CCGGAGATGCTTCGGCAGCTATTTACTCGAGTAAATAGCTGCCGAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027914
BBS10 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027914.1-2238s21c1
Sequence:CCGGCAGTGGGCAAAGGCATTTAATCTCGAGATTAAATGCCTTTGCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027914.1-1177s21c1
Sequence:CCGGATGTTCATCTCGGCTTGATTACTCGAGTAATCAAGCCGAGATGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027914.1-2163s21c1
Sequence:CCGGCAAGAATCAGAAGACGAATTTCTCGAGAAATTCGTCTTCTGATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027914.1-459s21c1
Sequence:CCGGTGTATTGTAGACCGGAGTTTACTCGAGTAAACTCCGGTCTACAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027914.1-1291s21c1
Sequence:CCGGAGATGCTTCGGCAGCTATTTACTCGAGTAAATAGCTGCCGAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027914
BBS10 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027914.1-2238s21c1
Sequence:CCGGCAGTGGGCAAAGGCATTTAATCTCGAGATTAAATGCCTTTGCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027914.1-1177s21c1
Sequence:CCGGATGTTCATCTCGGCTTGATTACTCGAGTAATCAAGCCGAGATGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027914.1-2163s21c1
Sequence:CCGGCAAGAATCAGAAGACGAATTTCTCGAGAAATTCGTCTTCTGATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027914.1-459s21c1
Sequence:CCGGTGTATTGTAGACCGGAGTTTACTCGAGTAAACTCCGGTCTACAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027914.1-1291s21c1
Sequence:CCGGAGATGCTTCGGCAGCTATTTACTCGAGTAAATAGCTGCCGAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks