EMAIL THIS PAGE TO A FRIEND

BBS12

Bardet-Biedl syndrome 12

Synonyms: C4orf24
UniProtKB ID: Q6ZW61, D3DNX5, Q7Z342, Q7Z482, Q8NAB8
Gene ID:
Human(166379) Summary: The protein encoded by this gene is part of a complex that is involved in membrane trafficking. The encoded protein is a molecular chaperone that aids in protein folding upon ATP hydrolysis. This protein also plays a role in adipocyte differentiation. Defects in this gene are a cause of Bardet-Biedl syndrome type 12. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
Mouse(241950) Bardet-Biedl syndrome 12 (human)
Rat(365770) Bardet-Biedl syndrome 12
Zebrafish(570583) Bardet-Biedl syndrome 12
cow(516376) Bardet-Biedl syndrome 12
Horse(100072131) Bardet-Biedl syndrome 12
domestic cat(101087153) Bardet-Biedl syndrome 12
dog(100686286) Bardet-Biedl syndrome 12
chicken(422667) Bardet-Biedl syndrome 12
naked mole-rat(101721278) Bardet-Biedl syndrome 12
domestic guinea pig(100727714) Bardet-Biedl syndrome 12
sheep(101103758) Bardet-Biedl syndrome 12
Domestic Rabbit(100357411) Bardet-Biedl syndrome 12
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152618 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001008502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152618 Rosetta Predictions human pricing
XM_001068963 Rosetta Predictions rat pricing
XM_345202 Rosetta Predictions rat pricing
NM_001008502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219118 predicted 1552
2 SASI_Hs01_00219119 predicted 1829
3 SASI_Hs01_00219121 predicted 1758
4 SASI_Hs02_00366477 predicted 1496
5 SASI_Hs01_00219123 predicted 750
6 SASI_Hs01_00219124 predicted 1234
7 SASI_Hs01_00219125 predicted 1435
8 SASI_Hs01_00219126 predicted 1016
9 SASI_Hs01_00219127 predicted 978
10 SASI_Hs02_00366478 predicted 851
11 SASI_Hs01_00219120 predicted 1286
12 SASI_Hs01_00219122 predicted 2092
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326407 predicted 1473
2 SASI_Rn02_00326408 predicted 627
3 SASI_Rn02_00326409 predicted 1488
4 SASI_Rn02_00326410 predicted 722
5 SASI_Rn02_00326411 predicted 1825
6 SASI_Rn02_00326412 predicted 1566
7 SASI_Rn02_00326413 predicted 486
8 SASI_Rn02_00326414 predicted 1130
9 SASI_Rn02_00326415 predicted 1062
10 SASI_Rn02_00326416 predicted 1780
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398051 predicted 1763
2 SASI_Rn02_00398052 predicted 435
3 SASI_Rn02_00398053 predicted 1833
4 SASI_Rn02_00398054 predicted 1843
5 SASI_Rn02_00398055 predicted 1779
6 SASI_Rn02_00398056 predicted 484
7 SASI_Rn02_00398057 predicted 406
8 SASI_Rn02_00398058 predicted 297
9 SASI_Rn02_00398059 predicted 480
10 SASI_Rn02_00398060 predicted 1777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039118 predicted 1572
2 SASI_Mm01_00039120 predicted 1271
3 SASI_Mm02_00286805 predicted 578
4 SASI_Mm01_00039121 predicted 1929
5 SASI_Mm01_00039123 predicted 1509
6 SASI_Mm02_00286806 predicted 1049
7 SASI_Mm01_00039125 predicted 1399
8 SASI_Mm02_00286807 predicted 2055
9 SASI_Mm01_00039126 predicted 1486
10 SASI_Mm01_00039127 predicted 1735
11 SASI_Mm01_00039119 predicted 351
12 SASI_Mm01_00039122 predicted 1148
13 SASI_Mm01_00039124 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152618
BBS12 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152618.2-883s21c1
Sequence:CCGGACTAATCCACAGTAGGCATTTCTCGAGAAATGCCTACTGTGGATTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152618.2-1443s21c1
Sequence:CCGGATGTGTCCGAACGCTTAATTGCTCGAGCAATTAAGCGTTCGGACACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152618.2-1199s21c1
Sequence:CCGGACTGTTGTGTCAGTATCTAATCTCGAGATTAGATACTGACACAACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152618.2-1250s1c1
Sequence:CCGGCCTGTGCGAATAGTTCTCATTCTCGAGAATGAGAACTATTCGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152618.2-2917s1c1
Sequence:CCGGCCTGAGATGTTCTTGGCCAAACTCGAGTTTGGCCAAGAACATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152618.2-1760s1c1
Sequence:CCGGGCCTATCGTTTGTATTATGCTCTCGAGAGCATAATACAAACGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152618.2-2215s1c1
Sequence:CCGGCCGAGCATTGGATTTAGTATTCTCGAGAATACTAAATCCAATGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152618.2-2010s1c1
Sequence:CCGGCTGCCAATTACTCATCAGAATCTCGAGATTCTGATGAGTAATTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152618
BBS12 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152618.2-883s21c1
Sequence:CCGGACTAATCCACAGTAGGCATTTCTCGAGAAATGCCTACTGTGGATTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152618.2-1443s21c1
Sequence:CCGGATGTGTCCGAACGCTTAATTGCTCGAGCAATTAAGCGTTCGGACACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152618.2-1199s21c1
Sequence:CCGGACTGTTGTGTCAGTATCTAATCTCGAGATTAGATACTGACACAACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152618.2-1250s1c1
Sequence:CCGGCCTGTGCGAATAGTTCTCATTCTCGAGAATGAGAACTATTCGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152618.2-2917s1c1
Sequence:CCGGCCTGAGATGTTCTTGGCCAAACTCGAGTTTGGCCAAGAACATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152618.2-1760s1c1
Sequence:CCGGGCCTATCGTTTGTATTATGCTCTCGAGAGCATAATACAAACGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152618.2-2215s1c1
Sequence:CCGGCCGAGCATTGGATTTAGTATTCTCGAGAATACTAAATCCAATGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152618.2-2010s1c1
Sequence:CCGGCTGCCAATTACTCATCAGAATCTCGAGATTCTGATGAGTAATTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152618
BBS12 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152618.2-883s21c1
Sequence:CCGGACTAATCCACAGTAGGCATTTCTCGAGAAATGCCTACTGTGGATTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152618.2-1443s21c1
Sequence:CCGGATGTGTCCGAACGCTTAATTGCTCGAGCAATTAAGCGTTCGGACACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152618.2-1199s21c1
Sequence:CCGGACTGTTGTGTCAGTATCTAATCTCGAGATTAGATACTGACACAACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152618.2-1250s1c1
Sequence:CCGGCCTGTGCGAATAGTTCTCATTCTCGAGAATGAGAACTATTCGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152618.2-2917s1c1
Sequence:CCGGCCTGAGATGTTCTTGGCCAAACTCGAGTTTGGCCAAGAACATCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152618.2-1760s1c1
Sequence:CCGGGCCTATCGTTTGTATTATGCTCTCGAGAGCATAATACAAACGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152618.2-2215s1c1
Sequence:CCGGCCGAGCATTGGATTTAGTATTCTCGAGAATACTAAATCCAATGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152618.2-2010s1c1
Sequence:CCGGCTGCCAATTACTCATCAGAATCTCGAGATTCTGATGAGTAATTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008502
VALIDATED
BBS12 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 12
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008502.1-1088s1c1
Sequence:CCGGGCTAGGACATTCATTCAACAACTCGAGTTGTTGAATGAATGTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008502.1-1271s1c1
Sequence:CCGGGCATTGGATGTAGTGCTCTTACTCGAGTAAGAGCACTACATCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008502.1-308s1c1
Sequence:CCGGCCTTTCCGAGTGATTCTCATTCTCGAGAATGAGAATCACTCGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008502.1-1522s1c1
Sequence:CCGGGCTGTATAAGAACAGCAAGCACTCGAGTGCTTGCTGTTCTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008502
VALIDATED
BBS12 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 12
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008502.1-1088s1c1
Sequence:CCGGGCTAGGACATTCATTCAACAACTCGAGTTGTTGAATGAATGTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008502.1-1271s1c1
Sequence:CCGGGCATTGGATGTAGTGCTCTTACTCGAGTAAGAGCACTACATCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008502.1-308s1c1
Sequence:CCGGCCTTTCCGAGTGATTCTCATTCTCGAGAATGAGAATCACTCGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008502.1-1522s1c1
Sequence:CCGGGCTGTATAAGAACAGCAAGCACTCGAGTGCTTGCTGTTCTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008502
VALIDATED
BBS12 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 12
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008502.1-1088s1c1
Sequence:CCGGGCTAGGACATTCATTCAACAACTCGAGTTGTTGAATGAATGTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008502.1-1271s1c1
Sequence:CCGGGCATTGGATGTAGTGCTCTTACTCGAGTAAGAGCACTACATCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001008502.1-308s1c1
Sequence:CCGGCCTTTCCGAGTGATTCTCATTCTCGAGAATGAGAATCACTCGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008502.1-1522s1c1
Sequence:CCGGGCTGTATAAGAACAGCAAGCACTCGAGTGCTTGCTGTTCTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks