EMAIL THIS PAGE TO A FRIEND

BBS1

Bardet-Biedl syndrome 1

68 Gene Product Result for
Synonyms: BBS2L2
UniProtKB ID: Q8NFJ9, Q32MN0, Q96SN4
Gene ID:
Human(582) Summary: Mutations in this gene have been observed in patients with the major form (type 1) of Bardet-Biedl syndrome. The encoded protein may play a role in eye, limb, cardiac and reproductive system development. [provided by RefSeq, Jul 2008]
Mouse(52028) Bardet-Biedl syndrome 1 (human)
Rat(309156) Bardet-Biedl syndrome 1
Zebrafish(568986) Bardet-Biedl syndrome 1
domestic cat(101086344) Bardet-Biedl syndrome 1
Horse(100629509) Bardet-Biedl syndrome 1
dog(483709) Bardet-Biedl syndrome 1
fruit fly(38780) CG14825 gene product from transcript CG14825-RA
cow(100848046) Bardet-Biedl syndrome 1
naked mole-rat(101721015) Bardet-Biedl syndrome 1
domestic guinea pig(100716990) Bardet-Biedl syndrome 1
sheep(101115491) Bardet-Biedl syndrome 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024649 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033128 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033128 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033128 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU193271 MISSION® esiRNA esiRNA targeting mouse Bbs1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024649 Rosetta Predictions human pricing
NM_001107569 Rosetta Predictions rat pricing
NM_001033128 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077103 predicted 391
2 SASI_Hs01_00077104 predicted 1082
3 SASI_Hs01_00077105 predicted 506
4 SASI_Hs01_00077106 predicted 398
5 SASI_Hs01_00077107 predicted 1004
6 SASI_Hs01_00077108 predicted 1820
7 SASI_Hs01_00077109 predicted 558
8 SASI_Hs01_00077110 predicted 810
9 SASI_Hs01_00077111 predicted 1368
10 SASI_Hs02_00357045 predicted 1060
11 SASI_Hs01_00077102 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230125 predicted 1495
2 SASI_Rn02_00230126 predicted 1535
3 SASI_Rn02_00230127 predicted 1112
4 SASI_Rn02_00230128 predicted 1187
5 SASI_Rn02_00230129 predicted 617
6 SASI_Rn02_00230130 predicted 417
7 SASI_Rn02_00230131 predicted 1340
8 SASI_Rn02_00230132 predicted 1831
9 SASI_Rn02_00230133 predicted 576
10 SASI_Rn02_00230134 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085351 predicted 361
2 SASI_Mm01_00085352 predicted 1500
3 SASI_Mm01_00085353 predicted 1836
4 SASI_Mm01_00085354 predicted 555
5 SASI_Mm01_00085355 predicted 1676
6 SASI_Mm01_00085357 predicted 390
7 SASI_Mm02_00288203 predicted 337
8 SASI_Mm01_00085359 predicted 1079
9 SASI_Mm01_00085360 predicted 539
10 SASI_Mm02_00288204 predicted 1843
11 SASI_Mm01_00085356 predicted 1804
12 SASI_Mm01_00085358 predicted 1163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024649
BBS1 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024649.4-1064s21c1
Sequence:CCGGCCAATGGAGAGGTCCGCATTTCTCGAGAAATGCGGACCTCTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024649.4-130s21c1
Sequence:CCGGTGCCTAGCGCTGGCAGATTTACTCGAGTAAATCTGCCAGCGCTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024649.4-344s21c1
Sequence:CCGGGTGTCTATGTGTATAAGAATCCTCGAGGATTCTTATACACATAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024649.4-2363s1c1
Sequence:CCGGCCCAGGAAACTTCTCTGAAATCTCGAGATTTCAGAGAAGTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024649.4-812s1c1
Sequence:CCGGGCCGCAATGGAAACATCTATACTCGAGTATAGATGTTTCCATTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024649.4-400s1c1
Sequence:CCGGCCTCCAAATCCTCTGGAACAACTCGAGTTGTTCCAGAGGATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024649.4-1501s1c1
Sequence:CCGGCCCACCTTTAAGCTCACACTTCTCGAGAAGTGTGAGCTTAAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024649.4-813s1c1
Sequence:CCGGCCGCAATGGAAACATCTATATCTCGAGATATAGATGTTTCCATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024649
BBS1 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024649.4-1064s21c1
Sequence:CCGGCCAATGGAGAGGTCCGCATTTCTCGAGAAATGCGGACCTCTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024649.4-130s21c1
Sequence:CCGGTGCCTAGCGCTGGCAGATTTACTCGAGTAAATCTGCCAGCGCTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024649.4-344s21c1
Sequence:CCGGGTGTCTATGTGTATAAGAATCCTCGAGGATTCTTATACACATAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024649.4-2363s1c1
Sequence:CCGGCCCAGGAAACTTCTCTGAAATCTCGAGATTTCAGAGAAGTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024649.4-812s1c1
Sequence:CCGGGCCGCAATGGAAACATCTATACTCGAGTATAGATGTTTCCATTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024649.4-400s1c1
Sequence:CCGGCCTCCAAATCCTCTGGAACAACTCGAGTTGTTCCAGAGGATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024649.4-1501s1c1
Sequence:CCGGCCCACCTTTAAGCTCACACTTCTCGAGAAGTGTGAGCTTAAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024649.4-813s1c1
Sequence:CCGGCCGCAATGGAAACATCTATATCTCGAGATATAGATGTTTCCATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024649
BBS1 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024649.4-1064s21c1
Sequence:CCGGCCAATGGAGAGGTCCGCATTTCTCGAGAAATGCGGACCTCTCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024649.4-130s21c1
Sequence:CCGGTGCCTAGCGCTGGCAGATTTACTCGAGTAAATCTGCCAGCGCTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024649.4-344s21c1
Sequence:CCGGGTGTCTATGTGTATAAGAATCCTCGAGGATTCTTATACACATAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024649.4-2363s1c1
Sequence:CCGGCCCAGGAAACTTCTCTGAAATCTCGAGATTTCAGAGAAGTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024649.4-812s1c1
Sequence:CCGGGCCGCAATGGAAACATCTATACTCGAGTATAGATGTTTCCATTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024649.4-400s1c1
Sequence:CCGGCCTCCAAATCCTCTGGAACAACTCGAGTTGTTCCAGAGGATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024649.4-1501s1c1
Sequence:CCGGCCCACCTTTAAGCTCACACTTCTCGAGAAGTGTGAGCTTAAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024649.4-813s1c1
Sequence:CCGGCCGCAATGGAAACATCTATATCTCGAGATATAGATGTTTCCATTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033128
BBS1 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033128.2-336s21c1
Sequence:CCGGGGCCTTGTGTCTATGTTTATACTCGAGTATAAACATAGACACAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033128.2-2893s21c1
Sequence:CCGGTGTCAGCTCTGGCACCATTAGCTCGAGCTAATGGTGCCAGAGCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033128.2-56s21c1
Sequence:CCGGAGCAACGAAGCCAATTCTAAACTCGAGTTTAGAATTGGCTTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033128.2-797s21c1
Sequence:CCGGTTGACTGCTGCCTGCCGAAATCTCGAGATTTCGGCAGGCAGCAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033128.2-572s21c1
Sequence:CCGGCAGCACAAGTCCAAGGTTATCCTCGAGGATAACCTTGGACTTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033128
BBS1 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033128.2-336s21c1
Sequence:CCGGGGCCTTGTGTCTATGTTTATACTCGAGTATAAACATAGACACAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033128.2-2893s21c1
Sequence:CCGGTGTCAGCTCTGGCACCATTAGCTCGAGCTAATGGTGCCAGAGCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033128.2-56s21c1
Sequence:CCGGAGCAACGAAGCCAATTCTAAACTCGAGTTTAGAATTGGCTTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033128.2-797s21c1
Sequence:CCGGTTGACTGCTGCCTGCCGAAATCTCGAGATTTCGGCAGGCAGCAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033128.2-572s21c1
Sequence:CCGGCAGCACAAGTCCAAGGTTATCCTCGAGGATAACCTTGGACTTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033128
BBS1 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033128.2-336s21c1
Sequence:CCGGGGCCTTGTGTCTATGTTTATACTCGAGTATAAACATAGACACAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252357    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033128.2-2893s21c1
Sequence:CCGGTGTCAGCTCTGGCACCATTAGCTCGAGCTAATGGTGCCAGAGCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033128.2-56s21c1
Sequence:CCGGAGCAACGAAGCCAATTCTAAACTCGAGTTTAGAATTGGCTTCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033128.2-797s21c1
Sequence:CCGGTTGACTGCTGCCTGCCGAAATCTCGAGATTTCGGCAGGCAGCAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033128.2-572s21c1
Sequence:CCGGCAGCACAAGTCCAAGGTTATCCTCGAGGATAACCTTGGACTTGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks