EMAIL THIS PAGE TO A FRIEND

BBS2

Bardet-Biedl syndrome 2

51 Gene Product Result for
Synonyms: BBS
UniProtKB ID: Q9BXC9, Q96CM0, Q96SN9
Gene ID:
Human(583) Summary: This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene forms a multiprotein BBSome complex with six other BBS proteins.[provided by RefSeq, Jan 2009]
Mouse(67378) Bardet-Biedl syndrome 2 (human)
Rat(113948) Bardet-Biedl syndrome 2
sheep(101118468) Bardet-Biedl syndrome 2
domestic guinea pig(100728338) Bardet-Biedl syndrome 2
naked mole-rat(101720407) Bardet-Biedl syndrome 2
Zebrafish(259187) Bardet-Biedl syndrome 2
chicken(415694) Bardet-Biedl syndrome 2
domestic cat(101080673) Bardet-Biedl syndrome 2
cow(533611) Bardet-Biedl syndrome 2
dog(478121) Bardet-Biedl syndrome 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031885 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031885 Rosetta Predictions human pricing
NM_053618 Rosetta Predictions rat pricing
NM_026116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125724 predicted 2150
2 SASI_Hs01_00125725 predicted 1027
3 SASI_Hs02_00358990 predicted 1622
4 SASI_Hs01_00125726 predicted 1046
5 SASI_Hs01_00125729 predicted 1618
6 SASI_Hs01_00125730 predicted 898
7 SASI_Hs01_00125731 predicted 1903
8 SASI_Hs02_00358991 predicted 740
9 SASI_Hs02_00358992 predicted 2598
10 SASI_Hs01_00125732 predicted 1608
11 SASI_Hs01_00125727 predicted 1601
12 SASI_Hs01_00125728 predicted 660
13 SASI_Hs01_00125733 predicted 2263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094370 predicted 397
2 SASI_Rn01_00094371 predicted 2207
3 SASI_Rn01_00094372 predicted 1292
4 SASI_Rn01_00094373 predicted 500
5 SASI_Rn01_00094374 predicted 1878
6 SASI_Rn01_00094375 predicted 884
7 SASI_Rn01_00094376 predicted 1762
8 SASI_Rn01_00094377 predicted 1271
9 SASI_Rn01_00094378 predicted 1902
10 SASI_Rn02_00266323 predicted 572
11 SASI_Rn01_00094379 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155667 predicted 2117
2 SASI_Mm01_00155668 predicted 758
3 SASI_Mm01_00155669 predicted 2717
4 SASI_Mm01_00155670 predicted 936
5 SASI_Mm02_00329695 predicted 1062
6 SASI_Mm01_00155671 predicted 2264
7 SASI_Mm01_00155672 predicted 963
8 SASI_Mm01_00155673 predicted 2423
9 SASI_Mm01_00155674 predicted 764
10 SASI_Mm01_00155675 predicted 1299
11 SASI_Mm01_00155676 predicted 2212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026116
BBS2 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026116.2-663s1c1
Sequence:CCGGGCTCAACATTAACCAGACGGTCTCGAGACCGTCTGGTTAATGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026116.2-2713s1c1
Sequence:CCGGCTAAGGATGAAACCATGCTAACTCGAGTTAGCATGGTTTCATCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026116.2-768s1c1
Sequence:CCGGCGACATCTACAATAATTCAGACTCGAGTCTGAATTATTGTAGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026116.2-2121s1c1
Sequence:CCGGCACTGTGAATACTGACGATATCTCGAGATATCGTCAGTATTCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026116.2-904s1c1
Sequence:CCGGCACGAAGGAAATGATCTCTTTCTCGAGAAAGAGATCATTTCCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026116.2-1645s21c1
Sequence:CCGGCAAGATGCGCATGCGGAATTACTCGAGTAATTCCGCATGCGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026116.2-1156s21c1
Sequence:CCGGGCCCGGTACTGGAGAATTAAACTCGAGTTTAATTCTCCAGTACCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026116.2-1237s21c1
Sequence:CCGGCTGATAACCGGGTGGTCTAATCTCGAGATTAGACCACCCGGTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026116
BBS2 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026116.2-663s1c1
Sequence:CCGGGCTCAACATTAACCAGACGGTCTCGAGACCGTCTGGTTAATGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026116.2-2713s1c1
Sequence:CCGGCTAAGGATGAAACCATGCTAACTCGAGTTAGCATGGTTTCATCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026116.2-768s1c1
Sequence:CCGGCGACATCTACAATAATTCAGACTCGAGTCTGAATTATTGTAGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026116.2-2121s1c1
Sequence:CCGGCACTGTGAATACTGACGATATCTCGAGATATCGTCAGTATTCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026116.2-904s1c1
Sequence:CCGGCACGAAGGAAATGATCTCTTTCTCGAGAAAGAGATCATTTCCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026116.2-1645s21c1
Sequence:CCGGCAAGATGCGCATGCGGAATTACTCGAGTAATTCCGCATGCGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026116.2-1156s21c1
Sequence:CCGGGCCCGGTACTGGAGAATTAAACTCGAGTTTAATTCTCCAGTACCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026116.2-1237s21c1
Sequence:CCGGCTGATAACCGGGTGGTCTAATCTCGAGATTAGACCACCCGGTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026116
BBS2 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026116.2-663s1c1
Sequence:CCGGGCTCAACATTAACCAGACGGTCTCGAGACCGTCTGGTTAATGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026116.2-2713s1c1
Sequence:CCGGCTAAGGATGAAACCATGCTAACTCGAGTTAGCATGGTTTCATCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026116.2-768s1c1
Sequence:CCGGCGACATCTACAATAATTCAGACTCGAGTCTGAATTATTGTAGATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026116.2-2121s1c1
Sequence:CCGGCACTGTGAATACTGACGATATCTCGAGATATCGTCAGTATTCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026116.2-904s1c1
Sequence:CCGGCACGAAGGAAATGATCTCTTTCTCGAGAAAGAGATCATTTCCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026116.2-1645s21c1
Sequence:CCGGCAAGATGCGCATGCGGAATTACTCGAGTAATTCCGCATGCGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026116.2-1156s21c1
Sequence:CCGGGCCCGGTACTGGAGAATTAAACTCGAGTTTAATTCTCCAGTACCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026116.2-1237s21c1
Sequence:CCGGCTGATAACCGGGTGGTCTAATCTCGAGATTAGACCACCCGGTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031885
VALIDATED
BBS2 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-2700s1c1
Sequence:CCGGCCTTGGTGAGTTGTACAAATTCTCGAGAATTTGTACAACTCACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-2516s1c1
Sequence:CCGGCGGGATGCAATTCGAAGCAATCTCGAGATTGCTTCGAATTGCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-1052s1c1
Sequence:CCGGCCCATGTATGGCAGTCGATTTCTCGAGAAATCGACTGCCATACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-1613s1c1
Sequence:CCGGGCTCATACAGAATTACGCATTCTCGAGAATGCGTAATTCTGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-1961s1c1
Sequence:CCGGCTCGGTCAGAACTTTCTGTTACTCGAGTAACAGAAAGTTCTGACCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031885.3-2586s21c1
Sequence:CCGGTAGTAGTACTGTTGCTGAATACTCGAGTATTCAGCAACAGTACTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031885.3-1708s21c1
Sequence:CCGGGCCAGTGAGCCAATCAGTTATCTCGAGATAACTGATTGGCTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031885.3-2191s21c1
Sequence:CCGGGACTTGCTAAATGGATATAAACTCGAGTTTATATCCATTTAGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031885.3-2149s21c1
Sequence:CCGGACAATGAAGAGTCGTTATATGCTCGAGCATATAACGACTCTTCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031885.3-2010s21c1
Sequence:CCGGATTACGAAAGGTGCTAGTTAACTCGAGTTAACTAGCACCTTTCGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031885
VALIDATED
BBS2 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-2700s1c1
Sequence:CCGGCCTTGGTGAGTTGTACAAATTCTCGAGAATTTGTACAACTCACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-2516s1c1
Sequence:CCGGCGGGATGCAATTCGAAGCAATCTCGAGATTGCTTCGAATTGCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-1052s1c1
Sequence:CCGGCCCATGTATGGCAGTCGATTTCTCGAGAAATCGACTGCCATACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-1613s1c1
Sequence:CCGGGCTCATACAGAATTACGCATTCTCGAGAATGCGTAATTCTGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-1961s1c1
Sequence:CCGGCTCGGTCAGAACTTTCTGTTACTCGAGTAACAGAAAGTTCTGACCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031885.3-2586s21c1
Sequence:CCGGTAGTAGTACTGTTGCTGAATACTCGAGTATTCAGCAACAGTACTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031885.3-1708s21c1
Sequence:CCGGGCCAGTGAGCCAATCAGTTATCTCGAGATAACTGATTGGCTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031885.3-2191s21c1
Sequence:CCGGGACTTGCTAAATGGATATAAACTCGAGTTTATATCCATTTAGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031885.3-2149s21c1
Sequence:CCGGACAATGAAGAGTCGTTATATGCTCGAGCATATAACGACTCTTCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031885.3-2010s21c1
Sequence:CCGGATTACGAAAGGTGCTAGTTAACTCGAGTTAACTAGCACCTTTCGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031885
VALIDATED
BBS2 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-2700s1c1
Sequence:CCGGCCTTGGTGAGTTGTACAAATTCTCGAGAATTTGTACAACTCACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-2516s1c1
Sequence:CCGGCGGGATGCAATTCGAAGCAATCTCGAGATTGCTTCGAATTGCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-1052s1c1
Sequence:CCGGCCCATGTATGGCAGTCGATTTCTCGAGAAATCGACTGCCATACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-1613s1c1
Sequence:CCGGGCTCATACAGAATTACGCATTCTCGAGAATGCGTAATTCTGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_031885.2-1961s1c1
Sequence:CCGGCTCGGTCAGAACTTTCTGTTACTCGAGTAACAGAAAGTTCTGACCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031885.3-2586s21c1
Sequence:CCGGTAGTAGTACTGTTGCTGAATACTCGAGTATTCAGCAACAGTACTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031885.3-1708s21c1
Sequence:CCGGGCCAGTGAGCCAATCAGTTATCTCGAGATAACTGATTGGCTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031885.3-2191s21c1
Sequence:CCGGGACTTGCTAAATGGATATAAACTCGAGTTTATATCCATTTAGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031885.3-2149s21c1
Sequence:CCGGACAATGAAGAGTCGTTATATGCTCGAGCATATAACGACTCTTCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031885.3-2010s21c1
Sequence:CCGGATTACGAAAGGTGCTAGTTAACTCGAGTTAACTAGCACCTTTCGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks