EMAIL THIS PAGE TO A FRIEND

BBS4

Bardet-Biedl syndrome 4

53 Gene Product Result for
UniProtKB ID: Q96RK4, B4E178, Q53DZ5, Q8NHU9, Q96H45
Gene ID:
Human(585) Summary: This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse. The similar phenotypes exhibited by mutations in BBS gene family members are likely due to the protein's shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene has sequence similarity to O-linked N-acetylglucosamine (O-GlcNAc) transferases in plants and archaebacteria and in human forms a multi-protein 'BBSome' complex with six other BBS proteins. Alternative splice variants have been described but their predicted protein products have not been experimentally verified.[provided by RefSeq, Jan 2009]
Mouse(102774) Bardet-Biedl syndrome 4 (human)
Rat(300754) Bardet-Biedl syndrome 4
Zebrafish(768303) Bardet-Biedl syndrome 4
fruit fly(36167) CG13232 gene product from transcript CG13232-RA
dog(487634) Bardet-Biedl syndrome 4
cow(532120) Bardet-Biedl syndrome 4
Horse(100063282) Bardet-Biedl syndrome 4
domestic cat(101090871) Bardet-Biedl syndrome 4
chicken(415318) Bardet-Biedl syndrome 4
naked mole-rat(101707988) Bardet-Biedl syndrome 4
sheep(101110416) Bardet-Biedl syndrome 4
Domestic Rabbit(100347284) Bardet-Biedl syndrome 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033028 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033028 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033028 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033028 Rosetta Predictions human pricing
NM_001106826 Rosetta Predictions rat pricing
NM_175325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154431 predicted 423
2 SASI_Hs01_00154432 predicted 915
3 SASI_Hs01_00154434 predicted 661
4 SASI_Hs01_00154435 predicted 199
5 SASI_Hs01_00154438 predicted 1248
6 SASI_Hs01_00154440 predicted 448
7 SASI_Hs02_00360714 predicted 1251
8 SASI_Hs02_00360715 predicted 1250
9 SASI_Hs02_00360716 predicted 1077
10 SASI_Hs02_00360717 predicted 1344
11 SASI_Hs01_00154433 predicted 1688
12 SASI_Hs01_00154436 predicted 1211
13 SASI_Hs01_00154437 predicted 290
14 SASI_Hs01_00154439 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222788 predicted 850
2 SASI_Rn02_00222789 predicted 207
3 SASI_Rn02_00222790 predicted 653
4 SASI_Rn02_00222791 predicted 890
5 SASI_Rn02_00222792 predicted 1369
6 SASI_Rn02_00222793 predicted 682
7 SASI_Rn02_00222794 predicted 770
8 SASI_Rn02_00222795 predicted 216
9 SASI_Rn02_00222796 predicted 441
10 SASI_Rn02_00222797 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198014 predicted 984
2 SASI_Mm01_00198015 predicted 418
3 SASI_Mm01_00198016 predicted 637
4 SASI_Mm02_00346104 predicted 283
5 SASI_Mm01_00198017 predicted 1372
6 SASI_Mm01_00198018 predicted 884
7 SASI_Mm01_00198019 predicted 1650
8 SASI_Mm01_00198021 predicted 670
9 SASI_Mm01_00198022 predicted 686
10 SASI_Mm01_00198023 predicted 773
11 SASI_Mm01_00198020 predicted 1471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033028
BBS4 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033028.3-331s21c1
Sequence:CCGGTAGTCCTCAGAGTGCTGATAACTCGAGTTATCAGCACTCTGAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033028.3-1086s21c1
Sequence:CCGGTGACCAATCTGGAAGATATAGCTCGAGCTATATCTTCCAGATTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033028.3-541s21c1
Sequence:CCGGGCACGATCTGACTTATATAATCTCGAGATTATATAAGTCAGATCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033028.3-462s21c1
Sequence:CCGGACCTAGGAGTTTGCTACATATCTCGAGATATGTAGCAAACTCCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033028.2-2020s1c1
Sequence:CCGGCCTCAGGTTGTGAGGTTTATTCTCGAGAATAAACCTCACAACCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033028.2-1132s1c1
Sequence:CCGGCCTGGATAAGTGTAACCCTTTCTCGAGAAAGGGTTACACTTATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033028.2-254s1c1
Sequence:CCGGGCATTGATATTTCGCCTAGAACTCGAGTTCTAGGCGAAATATCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033028.2-932s1c1
Sequence:CCGGGCACCCTTCGATTGGAAGATTCTCGAGAATCTTCCAATCGAAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033028
BBS4 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033028.3-331s21c1
Sequence:CCGGTAGTCCTCAGAGTGCTGATAACTCGAGTTATCAGCACTCTGAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033028.3-1086s21c1
Sequence:CCGGTGACCAATCTGGAAGATATAGCTCGAGCTATATCTTCCAGATTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033028.3-541s21c1
Sequence:CCGGGCACGATCTGACTTATATAATCTCGAGATTATATAAGTCAGATCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033028.3-462s21c1
Sequence:CCGGACCTAGGAGTTTGCTACATATCTCGAGATATGTAGCAAACTCCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033028.2-2020s1c1
Sequence:CCGGCCTCAGGTTGTGAGGTTTATTCTCGAGAATAAACCTCACAACCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033028.2-1132s1c1
Sequence:CCGGCCTGGATAAGTGTAACCCTTTCTCGAGAAAGGGTTACACTTATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033028.2-254s1c1
Sequence:CCGGGCATTGATATTTCGCCTAGAACTCGAGTTCTAGGCGAAATATCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033028.2-932s1c1
Sequence:CCGGGCACCCTTCGATTGGAAGATTCTCGAGAATCTTCCAATCGAAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033028
BBS4 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033028.3-331s21c1
Sequence:CCGGTAGTCCTCAGAGTGCTGATAACTCGAGTTATCAGCACTCTGAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033028.3-1086s21c1
Sequence:CCGGTGACCAATCTGGAAGATATAGCTCGAGCTATATCTTCCAGATTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033028.3-541s21c1
Sequence:CCGGGCACGATCTGACTTATATAATCTCGAGATTATATAAGTCAGATCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033028.3-462s21c1
Sequence:CCGGACCTAGGAGTTTGCTACATATCTCGAGATATGTAGCAAACTCCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033028.2-2020s1c1
Sequence:CCGGCCTCAGGTTGTGAGGTTTATTCTCGAGAATAAACCTCACAACCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033028.2-1132s1c1
Sequence:CCGGCCTGGATAAGTGTAACCCTTTCTCGAGAAAGGGTTACACTTATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033028.2-254s1c1
Sequence:CCGGGCATTGATATTTCGCCTAGAACTCGAGTTCTAGGCGAAATATCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033028.2-932s1c1
Sequence:CCGGGCACCCTTCGATTGGAAGATTCTCGAGAATCTTCCAATCGAAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175325
BBS4 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175325.2-2087s21c1
Sequence:CCGGTGGAATGAATCCAGCTATATTCTCGAGAATATAGCTGGATTCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175325.2-142s21c1
Sequence:CCGGCTGATCCATCTCCACTATATCCTCGAGGATATAGTGGAGATGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175325.2-528s1c1
Sequence:CCGGGCATGACCTGACTTACATAATCTCGAGATTATGTAAGTCAGGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175325.2-1129s21c1
Sequence:CCGGCTGGATAAGTGTAACCCTTTACTCGAGTAAAGGGTTACACTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175325.2-1334s21c1
Sequence:CCGGTCTGGACCAAACCAGTCAAAGCTCGAGCTTTGACTGGTTTGGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175325.2-528s21c1
Sequence:CCGGGCATGACCTGACTTACATAATCTCGAGATTATGTAAGTCAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175325.2-1867s1c1
Sequence:CCGGGCAAACGATGAAAGCCCGTAACTCGAGTTACGGGCTTTCATCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175325.2-1940s1c1
Sequence:CCGGGCTGTGGTAATGAAGCCTCATCTCGAGATGAGGCTTCATTACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175325.2-222s1c1
Sequence:CCGGGCTATGTGAATATGCTATCTACTCGAGTAGATAGCATATTCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175325
BBS4 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175325.2-2087s21c1
Sequence:CCGGTGGAATGAATCCAGCTATATTCTCGAGAATATAGCTGGATTCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175325.2-142s21c1
Sequence:CCGGCTGATCCATCTCCACTATATCCTCGAGGATATAGTGGAGATGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175325.2-528s1c1
Sequence:CCGGGCATGACCTGACTTACATAATCTCGAGATTATGTAAGTCAGGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175325.2-1129s21c1
Sequence:CCGGCTGGATAAGTGTAACCCTTTACTCGAGTAAAGGGTTACACTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175325.2-1334s21c1
Sequence:CCGGTCTGGACCAAACCAGTCAAAGCTCGAGCTTTGACTGGTTTGGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175325.2-528s21c1
Sequence:CCGGGCATGACCTGACTTACATAATCTCGAGATTATGTAAGTCAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175325.2-1867s1c1
Sequence:CCGGGCAAACGATGAAAGCCCGTAACTCGAGTTACGGGCTTTCATCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175325.2-1940s1c1
Sequence:CCGGGCTGTGGTAATGAAGCCTCATCTCGAGATGAGGCTTCATTACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175325.2-222s1c1
Sequence:CCGGGCTATGTGAATATGCTATCTACTCGAGTAGATAGCATATTCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175325
BBS4 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175325.2-2087s21c1
Sequence:CCGGTGGAATGAATCCAGCTATATTCTCGAGAATATAGCTGGATTCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175325.2-142s21c1
Sequence:CCGGCTGATCCATCTCCACTATATCCTCGAGGATATAGTGGAGATGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175325.2-528s1c1
Sequence:CCGGGCATGACCTGACTTACATAATCTCGAGATTATGTAAGTCAGGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175325.2-1129s21c1
Sequence:CCGGCTGGATAAGTGTAACCCTTTACTCGAGTAAAGGGTTACACTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175325.2-1334s21c1
Sequence:CCGGTCTGGACCAAACCAGTCAAAGCTCGAGCTTTGACTGGTTTGGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175325.2-528s21c1
Sequence:CCGGGCATGACCTGACTTACATAATCTCGAGATTATGTAAGTCAGGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175325.2-1867s1c1
Sequence:CCGGGCAAACGATGAAAGCCCGTAACTCGAGTTACGGGCTTTCATCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184504    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175325.2-1940s1c1
Sequence:CCGGGCTGTGGTAATGAAGCCTCATCTCGAGATGAGGCTTCATTACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183388    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175325.2-222s1c1
Sequence:CCGGGCTATGTGAATATGCTATCTACTCGAGTAGATAGCATATTCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks