EMAIL THIS PAGE TO A FRIEND

BBS5

Bardet-Biedl syndrome 5

67 Gene Product Result for
UniProtKB ID: Q8N3I7, D3DPC3, Q6PKN0
Gene ID:
Human(129880) Summary: This gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. Experimentation in non-human eukaryotes suggests that this gene is expressed in ciliated cells and that it is required for the formation of cilia. Alternate transcriptional splice variants have been observed but have not been fully characterized. [provided by RefSeq, Jul 2008]
Mouse(72569) Bardet-Biedl syndrome 5 (human)
Rat(362142) Bardet-Biedl syndrome 5
sheep(101120552) Bardet-Biedl syndrome 5
domestic guinea pig(100713052) Bardet-Biedl syndrome 5
naked mole-rat(101718158) Bardet-Biedl syndrome 5
Zebrafish(393269) Bardet-Biedl syndrome 5
cow(528191) Bardet-Biedl syndrome 5
domestic cat(101087595) Bardet-Biedl syndrome 5
dog(478783) Bardet-Biedl syndrome 5
chicken(424165) Bardet-Biedl syndrome 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408306 Anti-BBS5 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108094 Anti-BBS5 antibody produced in rabbit affinity isolated antibody zebrafish, canine, rat, horse, bovine, human, mouse, guinea pig
western blot pricing
SAB2100208 Anti-BBS5 antibody produced in rabbit affinity isolated antibody, lyophilized powder bovine, human, rat, chicken, canine, horse, mouse, zebrafish
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152384 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028284 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028284 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028284 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152384 Rosetta Predictions human pricing
NM_001108583 Rosetta Predictions rat pricing
NM_028284 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121737 predicted 930
2 SASI_Hs01_00121738 predicted 975
3 SASI_Hs01_00121739 predicted 564
4 SASI_Hs01_00121740 predicted 832
5 SASI_Hs01_00121741 predicted 611
6 SASI_Hs02_00366048 predicted 667
7 SASI_Hs02_00366049 predicted 1015
8 SASI_Hs01_00121743 predicted 252
9 SASI_Hs01_00121744 predicted 657
10 SASI_Hs01_00121745 predicted 490
11 SASI_Hs01_00121742 predicted 625
12 SASI_Hs01_00121746 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240069 predicted 807
2 SASI_Rn02_00240070 predicted 847
3 SASI_Rn02_00240071 predicted 474
4 SASI_Rn02_00240072 predicted 580
5 SASI_Rn02_00240073 predicted 265
6 SASI_Rn02_00240074 predicted 775
7 SASI_Rn02_00240075 predicted 947
8 SASI_Rn02_00240076 predicted 597
9 SASI_Rn02_00240077 predicted 928
10 SASI_Rn02_00240078 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119633 predicted 806
2 SASI_Mm01_00119634 predicted 239
3 SASI_Mm01_00119635 predicted 224
4 SASI_Mm01_00119636 predicted 949
5 SASI_Mm01_00119637 predicted 622
6 SASI_Mm01_00119638 predicted 849
7 SASI_Mm01_00119639 predicted 450
8 SASI_Mm01_00119640 predicted 860
9 SASI_Mm01_00119641 predicted 594
10 SASI_Mm01_00119642 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152384
BBS5 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152384.1-569s1c1
Sequence:CCGGCAGGGCAATTTAGGAACCTTTCTCGAGAAAGGTTCCTAAATTGCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152384.1-735s1c1
Sequence:CCGGGTGGATATGTTCTTGGCTTTACTCGAGTAAAGCCAAGAACATATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-830s1c1
Sequence:CCGGCCCATATTTGGAGTTGATTATCTCGAGATAATCAACTCCAAATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-262s1c1
Sequence:CCGGCGGTTACAATTGCATATTGAACTCGAGTTCAATATGCAATTGTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-125s1c1
Sequence:CCGGCCTGGAGAAGTCCTTATTGATCTCGAGATCAATAAGGACTTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-881s1c1
Sequence:CCGGGCTCTGACAGTCGAACAAATTCTCGAGAATTTGTTCGACTGTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-482s1c1
Sequence:CCGGGCACTAATTCAGAACAAGCAACTCGAGTTGCTTGTTCTGAATTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152384.2-648s21c1
Sequence:CCGGTTAATGTCAGTATACCATATCCTCGAGGATATGGTATACTGACATTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152384.2-986s21c1
Sequence:CCGGCAAGATCGTGAACCTGTATTTCTCGAGAAATACAGGTTCACGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152384
BBS5 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152384.1-569s1c1
Sequence:CCGGCAGGGCAATTTAGGAACCTTTCTCGAGAAAGGTTCCTAAATTGCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152384.1-735s1c1
Sequence:CCGGGTGGATATGTTCTTGGCTTTACTCGAGTAAAGCCAAGAACATATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-830s1c1
Sequence:CCGGCCCATATTTGGAGTTGATTATCTCGAGATAATCAACTCCAAATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-262s1c1
Sequence:CCGGCGGTTACAATTGCATATTGAACTCGAGTTCAATATGCAATTGTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-125s1c1
Sequence:CCGGCCTGGAGAAGTCCTTATTGATCTCGAGATCAATAAGGACTTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-881s1c1
Sequence:CCGGGCTCTGACAGTCGAACAAATTCTCGAGAATTTGTTCGACTGTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-482s1c1
Sequence:CCGGGCACTAATTCAGAACAAGCAACTCGAGTTGCTTGTTCTGAATTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152384.2-648s21c1
Sequence:CCGGTTAATGTCAGTATACCATATCCTCGAGGATATGGTATACTGACATTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152384.2-986s21c1
Sequence:CCGGCAAGATCGTGAACCTGTATTTCTCGAGAAATACAGGTTCACGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152384
BBS5 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152384.1-569s1c1
Sequence:CCGGCAGGGCAATTTAGGAACCTTTCTCGAGAAAGGTTCCTAAATTGCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152384.1-735s1c1
Sequence:CCGGGTGGATATGTTCTTGGCTTTACTCGAGTAAAGCCAAGAACATATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-830s1c1
Sequence:CCGGCCCATATTTGGAGTTGATTATCTCGAGATAATCAACTCCAAATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-262s1c1
Sequence:CCGGCGGTTACAATTGCATATTGAACTCGAGTTCAATATGCAATTGTAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-125s1c1
Sequence:CCGGCCTGGAGAAGTCCTTATTGATCTCGAGATCAATAAGGACTTCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-881s1c1
Sequence:CCGGGCTCTGACAGTCGAACAAATTCTCGAGAATTTGTTCGACTGTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152384.1-482s1c1
Sequence:CCGGGCACTAATTCAGAACAAGCAACTCGAGTTGCTTGTTCTGAATTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152384.2-648s21c1
Sequence:CCGGTTAATGTCAGTATACCATATCCTCGAGGATATGGTATACTGACATTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152384.2-986s21c1
Sequence:CCGGCAAGATCGTGAACCTGTATTTCTCGAGAAATACAGGTTCACGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028284
VALIDATED
BBS5 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028284.1-774s1c1
Sequence:CCGGGAGATCAACTCACTTCACAAACTCGAGTTTGTGAAGTGAGTTGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028284.1-226s1c1
Sequence:CCGGGAGTCAATCTTTCTATTGGTTCTCGAGAACCAATAGAAAGATTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191916    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028284.1-1117s1c1
Sequence:CCGGGCTGGACCTCTATTTAAAGATCTCGAGATCTTTAAATAGAGGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028284.2-270s21c1
Sequence:CCGGACAAGAACTGCTAACTCTAAACTCGAGTTTAGAGTTAGCAGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028284.2-1112s21c1
Sequence:CCGGGTTGAGCTGGACCTCTATTTACTCGAGTAAATAGAGGTCCAGCTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028284.2-796s21c1
Sequence:CCGGTCTATTCTGCCAGTCCAATATCTCGAGATATTGGACTGGCAGAATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028284.2-797s1c1
Sequence:CCGGCTATTCTGCCAGTCCAATATTCTCGAGAATATTGGACTGGCAGAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028284.2-505s21c1
Sequence:CCGGATGTGTATGATAAGATCAATGCTCGAGCATTGATCTTATCATACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028284.2-636s21c1
Sequence:CCGGTATCTGCAAATTCGTTCAATACTCGAGTATTGAACGAATTTGCAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028284
VALIDATED
BBS5 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028284.1-774s1c1
Sequence:CCGGGAGATCAACTCACTTCACAAACTCGAGTTTGTGAAGTGAGTTGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028284.1-226s1c1
Sequence:CCGGGAGTCAATCTTTCTATTGGTTCTCGAGAACCAATAGAAAGATTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191916    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028284.1-1117s1c1
Sequence:CCGGGCTGGACCTCTATTTAAAGATCTCGAGATCTTTAAATAGAGGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028284.2-270s21c1
Sequence:CCGGACAAGAACTGCTAACTCTAAACTCGAGTTTAGAGTTAGCAGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028284.2-1112s21c1
Sequence:CCGGGTTGAGCTGGACCTCTATTTACTCGAGTAAATAGAGGTCCAGCTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028284.2-796s21c1
Sequence:CCGGTCTATTCTGCCAGTCCAATATCTCGAGATATTGGACTGGCAGAATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028284.2-797s1c1
Sequence:CCGGCTATTCTGCCAGTCCAATATTCTCGAGAATATTGGACTGGCAGAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028284.2-505s21c1
Sequence:CCGGATGTGTATGATAAGATCAATGCTCGAGCATTGATCTTATCATACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028284.2-636s21c1
Sequence:CCGGTATCTGCAAATTCGTTCAATACTCGAGTATTGAACGAATTTGCAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028284
VALIDATED
BBS5 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028284.1-774s1c1
Sequence:CCGGGAGATCAACTCACTTCACAAACTCGAGTTTGTGAAGTGAGTTGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028284.1-226s1c1
Sequence:CCGGGAGTCAATCTTTCTATTGGTTCTCGAGAACCAATAGAAAGATTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191916    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028284.1-1117s1c1
Sequence:CCGGGCTGGACCTCTATTTAAAGATCTCGAGATCTTTAAATAGAGGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028284.2-270s21c1
Sequence:CCGGACAAGAACTGCTAACTCTAAACTCGAGTTTAGAGTTAGCAGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248516    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028284.2-1112s21c1
Sequence:CCGGGTTGAGCTGGACCTCTATTTACTCGAGTAAATAGAGGTCCAGCTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028284.2-796s21c1
Sequence:CCGGTCTATTCTGCCAGTCCAATATCTCGAGATATTGGACTGGCAGAATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028284.2-797s1c1
Sequence:CCGGCTATTCTGCCAGTCCAATATTCTCGAGAATATTGGACTGGCAGAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028284.2-505s21c1
Sequence:CCGGATGTGTATGATAAGATCAATGCTCGAGCATTGATCTTATCATACACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028284.2-636s21c1
Sequence:CCGGTATCTGCAAATTCGTTCAATACTCGAGTATTGAACGAATTTGCAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)