EMAIL THIS PAGE TO A FRIEND

BBS7

Bardet-Biedl syndrome 7

72 Gene Product Result for
Synonyms: BBS2L1
UniProtKB ID: Q8IWZ6, Q4W5P8, Q8N581, Q9NVI4
Gene ID:
Human(55212) Summary: This gene encodes one of seven proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8 and BBS9. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Feb 2011]
Mouse(71492) Bardet-Biedl syndrome 7 (human)
Rat(361930) Bardet-Biedl syndrome 7
Zebrafish(557491) Bardet-Biedl syndrome 7
domestic cat(101088159) Bardet-Biedl syndrome 7
cow(100138953) Bardet-Biedl syndrome 7
Horse(100063923) Bardet-Biedl syndrome 7
dog(476092) Bardet-Biedl syndrome 7
chicken(771481) Bardet-Biedl syndrome 7
naked mole-rat(101718716) Bardet-Biedl syndrome 7
domestic guinea pig(100717774) Bardet-Biedl syndrome 7
sheep(101107867) Bardet-Biedl syndrome 7
Domestic Rabbit(100356131) Bardet-Biedl syndrome 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018190 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018190 Rosetta Predictions human pricing
NM_176824 Rosetta Predictions human pricing
NM_001012180 Rosetta Predictions rat pricing
XM_574923 Rosetta Predictions rat pricing
NM_027810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351458 predicted 1207
2 SASI_Hs01_00080375 predicted 1370
3 SASI_Hs01_00080376 predicted 1702
4 SASI_Hs01_00080378 predicted 1370
5 SASI_Hs02_00351459 predicted 1024
6 SASI_Hs01_00080379 predicted 1655
7 SASI_Hs01_00080380 predicted 1070
8 SASI_Hs01_00080381 predicted 1938
9 SASI_Hs01_00080382 predicted 1080
10 SASI_Hs01_00080383 predicted 1354
11 SASI_Hs01_00080377 predicted 1356
12 SASI_Hs01_00080384 predicted 1734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369252 predicted 1202
2 SASI_Hs01_00048850 predicted 1371
3 SASI_Hs01_00048851 predicted 1700
4 SASI_Hs01_00048853 predicted 1375
5 SASI_Hs02_00369253 predicted 1021
6 SASI_Hs01_00048854 predicted 1658
7 SASI_Hs01_00048855 predicted 1070
8 SASI_Hs01_00048856 predicted 1940
9 SASI_Hs01_00048857 predicted 1082
10 SASI_Hs01_00048858 predicted 1349
11 SASI_Hs01_00048852 predicted 1350
12 SASI_Hs01_00048859 predicted 1735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074596 predicted 2047
2 SASI_Rn01_00074597 predicted 1580
3 SASI_Rn01_00074598 predicted 1873
4 SASI_Rn01_00074599 predicted 2056
5 SASI_Rn01_00074600 predicted 2102
6 SASI_Rn01_00074601 predicted 1904
7 SASI_Rn01_00074603 predicted 1299
8 SASI_Rn01_00074604 predicted 1043
9 SASI_Rn01_00074605 predicted 1429
10 SASI_Rn02_00200385 predicted 475
11 SASI_Rn01_00074602 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00124342 predicted 2201
2 SASI_Rn01_00124343 predicted 2293
3 SASI_Rn01_00124344 predicted 2051
4 SASI_Rn01_00124345 predicted 2070
5 SASI_Rn01_00124346 predicted 2106
6 SASI_Rn01_00124347 predicted 326
7 SASI_Rn01_00124348 predicted 2004
8 SASI_Rn01_00124349 predicted 1939
9 SASI_Rn01_00124350 predicted 384
10 SASI_Rn01_00124351 predicted 2252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176187 predicted 1050
2 SASI_Mm01_00176188 predicted 1274
3 SASI_Mm01_00176189 predicted 472
4 SASI_Mm01_00176190 predicted 1961
5 SASI_Mm01_00176191 predicted 1738
6 SASI_Mm01_00176192 predicted 2097
7 SASI_Mm01_00176193 predicted 1873
8 SASI_Mm01_00176194 predicted 743
9 SASI_Mm02_00332752 predicted 2059
10 SASI_Mm01_00176196 predicted 679
11 SASI_Mm01_00176195 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018190
VALIDATED
BBS7 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1084s21c1
Sequence:CCGGGAAATCGTGGTGTCCACATATCTCGAGATATGTGGACACCACGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018190.2-2314s21c1
Sequence:CCGGATGAATCAGTTGACAACAAATCTCGAGATTTGTTGTCAACTGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1298s21c1
Sequence:CCGGCAGTACCTTCCTTTGGTATAACTCGAGTTATACCAAAGGAAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1371s21c1
Sequence:CCGGGGTACAGACTGCAATAGATAACTCGAGTTATCTATTGCAGTCTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1209s21c1
Sequence:CCGGACGGAATGAGTTGGAACATTTCTCGAGAAATGTTCCAACTCATTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1537s21c1
Sequence:CCGGGAACTCAAGATTCGCTCAATTCTCGAGAATTGAGCGAATCTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018190.2-2204s21c1
Sequence:CCGGTAGAATACCTTGCCATATTTCCTCGAGGAAATATGGCAAGGTATTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018190.2-2242s1c1
Sequence:CCGGCCCAAGGATCATGTAAGAGAACTCGAGTTCTCTTACATGATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018190.2-337s1c1
Sequence:CCGGGCAGCAGTGTTCAAGACTTTACTCGAGTAAAGTCTTGAACACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018190.2-1944s1c1
Sequence:CCGGCCTCAACATATCATACGAGATCTCGAGATCTCGTATGATATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018190.2-1687s1c1
Sequence:CCGGCCCATGAATACACTGACCCTACTCGAGTAGGGTCAGTGTATTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018190.2-1783s1c1
Sequence:CCGGGCAGGAGAATGTGTGACATTTCTCGAGAAATGTCACACATTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018190
VALIDATED
BBS7 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1084s21c1
Sequence:CCGGGAAATCGTGGTGTCCACATATCTCGAGATATGTGGACACCACGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018190.2-2314s21c1
Sequence:CCGGATGAATCAGTTGACAACAAATCTCGAGATTTGTTGTCAACTGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1298s21c1
Sequence:CCGGCAGTACCTTCCTTTGGTATAACTCGAGTTATACCAAAGGAAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1371s21c1
Sequence:CCGGGGTACAGACTGCAATAGATAACTCGAGTTATCTATTGCAGTCTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1209s21c1
Sequence:CCGGACGGAATGAGTTGGAACATTTCTCGAGAAATGTTCCAACTCATTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1537s21c1
Sequence:CCGGGAACTCAAGATTCGCTCAATTCTCGAGAATTGAGCGAATCTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018190.2-2204s21c1
Sequence:CCGGTAGAATACCTTGCCATATTTCCTCGAGGAAATATGGCAAGGTATTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018190.2-2242s1c1
Sequence:CCGGCCCAAGGATCATGTAAGAGAACTCGAGTTCTCTTACATGATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018190.2-337s1c1
Sequence:CCGGGCAGCAGTGTTCAAGACTTTACTCGAGTAAAGTCTTGAACACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018190.2-1944s1c1
Sequence:CCGGCCTCAACATATCATACGAGATCTCGAGATCTCGTATGATATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018190.2-1687s1c1
Sequence:CCGGCCCATGAATACACTGACCCTACTCGAGTAGGGTCAGTGTATTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018190.2-1783s1c1
Sequence:CCGGGCAGGAGAATGTGTGACATTTCTCGAGAAATGTCACACATTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018190
VALIDATED
BBS7 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1084s21c1
Sequence:CCGGGAAATCGTGGTGTCCACATATCTCGAGATATGTGGACACCACGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018190.2-2314s21c1
Sequence:CCGGATGAATCAGTTGACAACAAATCTCGAGATTTGTTGTCAACTGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1298s21c1
Sequence:CCGGCAGTACCTTCCTTTGGTATAACTCGAGTTATACCAAAGGAAGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1371s21c1
Sequence:CCGGGGTACAGACTGCAATAGATAACTCGAGTTATCTATTGCAGTCTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1209s21c1
Sequence:CCGGACGGAATGAGTTGGAACATTTCTCGAGAAATGTTCCAACTCATTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018190.2-1537s21c1
Sequence:CCGGGAACTCAAGATTCGCTCAATTCTCGAGAATTGAGCGAATCTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018190.2-2204s21c1
Sequence:CCGGTAGAATACCTTGCCATATTTCCTCGAGGAAATATGGCAAGGTATTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018190.2-2242s1c1
Sequence:CCGGCCCAAGGATCATGTAAGAGAACTCGAGTTCTCTTACATGATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018190.2-337s1c1
Sequence:CCGGGCAGCAGTGTTCAAGACTTTACTCGAGTAAAGTCTTGAACACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_018190.2-1944s1c1
Sequence:CCGGCCTCAACATATCATACGAGATCTCGAGATCTCGTATGATATGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018190.2-1687s1c1
Sequence:CCGGCCCATGAATACACTGACCCTACTCGAGTAGGGTCAGTGTATTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018190.2-1783s1c1
Sequence:CCGGGCAGGAGAATGTGTGACATTTCTCGAGAAATGTCACACATTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027810
VALIDATED
BBS7 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027810.3-1312s1c1
Sequence:CCGGCAATAGACAATGTCCTAATACCTCGAGGTATTAGGACATTGTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027810.3-355s21c1
Sequence:CCGGTTGCTGCAGGGTCCGAGATTACTCGAGTAATCTCGGACCCTGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027810.3-1877s21c1
Sequence:CCGGCAACATATCATACGAGATAAACTCGAGTTTATCTCGTATGATATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027810.3-2324s21c1
Sequence:CCGGGATGGACGTCCCACATGTAATCTCGAGATTACATGTGGGACGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027810.3-1467s21c1
Sequence:CCGGGAGCTCAAGATTCGTTCAATTCTCGAGAATTGAACGAATCTTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027810.3-1312s21c1
Sequence:CCGGCAATAGACAATGTCCTAATACCTCGAGGTATTAGGACATTGTCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027810.1-2376s1c1
Sequence:CCGGCGAGTACCCATGAAAGTCCTTCTCGAGAAGGACTTTCATGGGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027810.1-763s1c1
Sequence:CCGGGATCACAACATCCAAACCAATCTCGAGATTGGTTTGGATGTTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179774    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027810.1-2377s1c1
Sequence:CCGGGAGTACCCATGAAAGTCCTTTCTCGAGAAAGGACTTTCATGGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027810
VALIDATED
BBS7 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027810.3-1312s1c1
Sequence:CCGGCAATAGACAATGTCCTAATACCTCGAGGTATTAGGACATTGTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027810.3-355s21c1
Sequence:CCGGTTGCTGCAGGGTCCGAGATTACTCGAGTAATCTCGGACCCTGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027810.3-1877s21c1
Sequence:CCGGCAACATATCATACGAGATAAACTCGAGTTTATCTCGTATGATATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027810.3-2324s21c1
Sequence:CCGGGATGGACGTCCCACATGTAATCTCGAGATTACATGTGGGACGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027810.3-1467s21c1
Sequence:CCGGGAGCTCAAGATTCGTTCAATTCTCGAGAATTGAACGAATCTTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027810.3-1312s21c1
Sequence:CCGGCAATAGACAATGTCCTAATACCTCGAGGTATTAGGACATTGTCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027810.1-2376s1c1
Sequence:CCGGCGAGTACCCATGAAAGTCCTTCTCGAGAAGGACTTTCATGGGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027810.1-763s1c1
Sequence:CCGGGATCACAACATCCAAACCAATCTCGAGATTGGTTTGGATGTTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179774    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027810.1-2377s1c1
Sequence:CCGGGAGTACCCATGAAAGTCCTTTCTCGAGAAAGGACTTTCATGGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027810
VALIDATED
BBS7 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027810.3-1312s1c1
Sequence:CCGGCAATAGACAATGTCCTAATACCTCGAGGTATTAGGACATTGTCTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027810.3-355s21c1
Sequence:CCGGTTGCTGCAGGGTCCGAGATTACTCGAGTAATCTCGGACCCTGCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027810.3-1877s21c1
Sequence:CCGGCAACATATCATACGAGATAAACTCGAGTTTATCTCGTATGATATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027810.3-2324s21c1
Sequence:CCGGGATGGACGTCCCACATGTAATCTCGAGATTACATGTGGGACGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027810.3-1467s21c1
Sequence:CCGGGAGCTCAAGATTCGTTCAATTCTCGAGAATTGAACGAATCTTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027810.3-1312s21c1
Sequence:CCGGCAATAGACAATGTCCTAATACCTCGAGGTATTAGGACATTGTCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027810.1-2376s1c1
Sequence:CCGGCGAGTACCCATGAAAGTCCTTCTCGAGAAGGACTTTCATGGGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027810.1-763s1c1
Sequence:CCGGGATCACAACATCCAAACCAATCTCGAGATTGGTTTGGATGTTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179774    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027810.1-2377s1c1
Sequence:CCGGGAGTACCCATGAAAGTCCTTTCTCGAGAAAGGACTTTCATGGGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks