EMAIL THIS PAGE TO A FRIEND

BBS9

Bardet-Biedl syndrome 9

237 Gene Product Result for
Synonyms: B1 C18 D1 PTHB1
Gene ID:
Human(27241) Summary: This gene is downregulated by parathyroid hormone in osteoblastic cells, and therefore, is thought to be involved in parathyroid hormone action in bones. The exact function of this gene has not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(319845) Bardet-Biedl syndrome 9 (human)
Rat(315484) Bardet-Biedl syndrome 9
Zebrafish(100333716) Bardet-Biedl syndrome 9
cow(535387) Bardet-Biedl syndrome 9
Horse(100055338) Bardet-Biedl syndrome 9
domestic cat(101091858) Bardet-Biedl syndrome 9
dog(482393) Bardet-Biedl syndrome 9
chicken(420745) Bardet-Biedl syndrome 9
sheep(101118868) Bardet-Biedl syndrome 9
Domestic Rabbit(100348573) Bardet-Biedl syndrome 9
domestic guinea pig(100720878) Bardet-Biedl syndrome 9
naked mole-rat(101707127) Bardet-Biedl syndrome 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181316 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181316 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181316 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198428 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033604 Rosetta Predictions human pricing
NM_001033605 Rosetta Predictions human pricing
NM_014451 Rosetta Predictions human pricing
NM_198428 Rosetta Predictions human pricing
XM_001074489 Rosetta Predictions rat pricing
XM_001074523 Rosetta Predictions rat pricing
XM_001074552 Rosetta Predictions rat pricing
XM_001074574 Rosetta Predictions rat pricing
XM_001074605 Rosetta Predictions rat pricing
XM_001074631 Rosetta Predictions rat pricing
XM_235942 Rosetta Predictions rat pricing
NM_178415 Rosetta Predictions mouse pricing
NM_181316 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308079 predicted 728
2 SASI_Hs01_00118068 predicted 531
3 SASI_Hs01_00118069 predicted 1607
4 SASI_Hs01_00118071 predicted 1247
5 SASI_Hs02_00308080 predicted 2220
6 SASI_Hs01_00118073 predicted 2647
7 SASI_Hs01_00118074 predicted 1319
8 SASI_Hs01_00118075 predicted 932
9 SASI_Hs01_00118076 predicted 2236
10 SASI_Hs01_00118077 predicted 1107
11 SASI_Hs01_00118070 predicted 580
12 SASI_Hs01_00118072 predicted 2231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308081 predicted 725
2 SASI_Hs01_00010996 predicted 526
3 SASI_Hs01_00010997 predicted 1607
4 SASI_Hs01_00010999 predicted 1239
5 SASI_Hs02_00308082 predicted 2313
6 SASI_Hs01_00011001 predicted 2738
7 SASI_Hs01_00011002 predicted 1315
8 SASI_Hs01_00011003 predicted 930
9 SASI_Hs01_00011004 predicted 2322
10 SASI_Hs01_00011005 predicted 1104
11 SASI_Hs01_00010998 predicted 577
12 SASI_Hs01_00011000 predicted 2322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345664 predicted 727
2 SASI_Hs01_00059108 predicted 528
3 SASI_Hs01_00059109 predicted 1602
4 SASI_Hs01_00059111 predicted 1240
5 SASI_Hs02_00345665 predicted 2208
6 SASI_Hs01_00059113 predicted 2637
7 SASI_Hs01_00059114 predicted 1317
8 SASI_Hs01_00059115 predicted 931
9 SASI_Hs01_00059116 predicted 2216
10 SASI_Hs01_00059117 predicted 1109
11 SASI_Hs01_00059110 predicted 577
12 SASI_Hs01_00059112 predicted 2209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371941 predicted 720
2 SASI_Hs01_00135419 predicted 529
3 SASI_Hs01_00135420 predicted 1599
4 SASI_Hs01_00135422 predicted 1241
5 SASI_Hs02_00371942 predicted 2327
6 SASI_Hs01_00135424 predicted 2759
7 SASI_Hs01_00135425 predicted 1319
8 SASI_Hs01_00135426 predicted 924
9 SASI_Hs01_00135427 predicted 2337
10 SASI_Hs01_00135428 predicted 1110
11 SASI_Hs01_00135421 predicted 586
12 SASI_Hs01_00135423 predicted 2335
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074489 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346426 predicted 860
2 SASI_Rn02_00346427 predicted 1351
3 SASI_Rn02_00346428 predicted 1897
4 SASI_Rn02_00346429 predicted 1901
5 SASI_Rn02_00346430 predicted 1962
6 SASI_Rn02_00346431 predicted 512
7 SASI_Rn02_00346432 predicted 1551
8 SASI_Rn02_00346433 predicted 2050
9 SASI_Rn02_00346434 predicted 1745
10 SASI_Rn02_00346435 predicted 2755
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346526 predicted 785
2 SASI_Rn02_00346527 predicted 1787
3 SASI_Rn02_00346528 predicted 1278
4 SASI_Rn02_00346529 predicted 1795
5 SASI_Rn02_00346530 predicted 438
6 SASI_Rn02_00346531 predicted 1480
7 SASI_Rn02_00346532 predicted 1892
8 SASI_Rn02_00346533 predicted 1662
9 SASI_Rn02_00346534 predicted 2596
10 SASI_Rn02_00346535 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346630 predicted 788
2 SASI_Rn02_00346631 predicted 1279
3 SASI_Rn02_00346632 predicted 1776
4 SASI_Rn02_00346633 predicted 440
5 SASI_Rn02_00346634 predicted 1479
6 SASI_Rn02_00346635 predicted 1875
7 SASI_Rn02_00346636 predicted 1665
8 SASI_Rn02_00346637 predicted 2576
9 SASI_Rn02_00346638 predicted 1244
10 SASI_Rn02_00346639 predicted 1867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346710 predicted 781
2 SASI_Rn02_00346711 predicted 1887
3 SASI_Rn02_00346712 predicted 1282
4 SASI_Rn02_00346713 predicted 1820
5 SASI_Rn02_00346714 predicted 1829
6 SASI_Rn02_00346715 predicted 1904
7 SASI_Rn02_00346716 predicted 435
8 SASI_Rn02_00346717 predicted 1481
9 SASI_Rn02_00346718 predicted 1994
10 SASI_Rn02_00346719 predicted 1670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346777 predicted 944
2 SASI_Rn02_00346778 predicted 1429
3 SASI_Rn02_00346779 predicted 1975
4 SASI_Rn02_00346780 predicted 1987
5 SASI_Rn02_00346781 predicted 2037
6 SASI_Rn02_00346782 predicted 595
7 SASI_Rn02_00346783 predicted 1631
8 SASI_Rn02_00346784 predicted 2135
9 SASI_Rn02_00346785 predicted 1817
10 SASI_Rn02_00346786 predicted 2840
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346836 predicted 808
2 SASI_Rn02_00346837 predicted 1302
3 SASI_Rn02_00346838 predicted 1833
4 SASI_Rn02_00346839 predicted 1848
5 SASI_Rn02_00346840 predicted 1906
6 SASI_Rn02_00346841 predicted 455
7 SASI_Rn02_00346842 predicted 1497
8 SASI_Rn02_00346843 predicted 1998
9 SASI_Rn02_00346844 predicted 1689
10 SASI_Rn02_00346845 predicted 2704
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389755 predicted 2760
2 SASI_Rn02_00389756 predicted 2523
3 SASI_Rn02_00389757 predicted 2778
4 SASI_Rn02_00389758 predicted 2658
5 SASI_Rn02_00389759 predicted 2341
6 SASI_Rn02_00389760 predicted 2622
7 SASI_Rn02_00389761 predicted 2626
8 SASI_Rn02_00389762 predicted 2791
9 SASI_Rn02_00389763 predicted 267
10 SASI_Rn02_00389764 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348870 predicted 2204
2 SASI_Mm02_00348871 predicted 2037
3 SASI_Mm02_00348872 predicted 1891
4 SASI_Mm02_00348873 predicted 1120
5 SASI_Mm02_00348874 predicted 596
6 SASI_Mm02_00348875 predicted 1885
7 SASI_Mm02_00348876 predicted 1649
8 SASI_Mm02_00348877 predicted 2745
9 SASI_Mm02_00348878 predicted 1165
10 SASI_Mm02_00348879 predicted 1789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060414 predicted 2144
2 SASI_Mm01_00060415 predicted 1986
3 SASI_Mm01_00060416 predicted 1837
4 SASI_Mm02_00349669 predicted 1064
5 SASI_Mm02_00349670 predicted 539
6 SASI_Mm01_00060419 predicted 1827
7 SASI_Mm01_00060420 predicted 1593
8 SASI_Mm01_00060421 predicted 2692
9 SASI_Mm01_00060422 predicted 1111
10 SASI_Mm01_00060423 predicted 1731
11 SASI_Mm01_00060417 predicted 430
12 SASI_Mm01_00060418 predicted 3037
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181316
VALIDATED
BBS9 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 9
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181316.3-2788s1c1
Sequence:CCGGGCTGTGTGATAGGTTAGCCAACTCGAGTTGGCTAACCTATCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181316.3-3226s1c1
Sequence:CCGGCTTTAGTCACATGCGCTTATACTCGAGTATAAGCGCATGTGACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181316.3-3224s1c1
Sequence:CCGGGCCTTTAGTCACATGCGCTTACTCGAGTAAGCGCATGTGACTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181316.3-1751s1c1
Sequence:CCGGCCACTACAGTTGACTTGTGATCTCGAGATCACAAGTCAACTGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181316.3-3225s1c1
Sequence:CCGGCCTTTAGTCACATGCGCTTATCTCGAGATAAGCGCATGTGACTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181316.3-1988s1c1
Sequence:CCGGCTAACTATAGACACCAACAAACTCGAGTTTGTTGGTGTCTATAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181316.3-957s1c1
Sequence:CCGGCTTGCAGACAAGTGGAAAGTTCTCGAGAACTTTCCACTTGTCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181316.4-1739s21c1
Sequence:CCGGCCACTACAGTTGACTTGTGATCTCGAGATCACAAGTCAACTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181316.4-3214s21c1
Sequence:CCGGCTTTAGTCACATGCGCTTATACTCGAGTATAAGCGCATGTGACTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181316.4-1274s1c1
Sequence:CCGGCATAACCACATGCTGCATATTCTCGAGAATATGCAGCATGTGGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181316.4-1964s21c1
Sequence:CCGGGCAAGCCACAAACTAACTATACTCGAGTATAGTTAGTTTGTGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181316.4-1189s21c1
Sequence:CCGGCATGAAGAAGCTCGGTTATAACTCGAGTTATAACCGAGCTTCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181316.4-449s21c1
Sequence:CCGGAGTGGGAACGGCCACGATAAACTCGAGTTTATCGTGGCCGTTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181316
VALIDATED
BBS9 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 9
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181316.3-2788s1c1
Sequence:CCGGGCTGTGTGATAGGTTAGCCAACTCGAGTTGGCTAACCTATCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181316.3-3226s1c1
Sequence:CCGGCTTTAGTCACATGCGCTTATACTCGAGTATAAGCGCATGTGACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181316.3-3224s1c1
Sequence:CCGGGCCTTTAGTCACATGCGCTTACTCGAGTAAGCGCATGTGACTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181316.3-1751s1c1
Sequence:CCGGCCACTACAGTTGACTTGTGATCTCGAGATCACAAGTCAACTGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181316.3-3225s1c1
Sequence:CCGGCCTTTAGTCACATGCGCTTATCTCGAGATAAGCGCATGTGACTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181316.3-1988s1c1
Sequence:CCGGCTAACTATAGACACCAACAAACTCGAGTTTGTTGGTGTCTATAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181316.3-957s1c1
Sequence:CCGGCTTGCAGACAAGTGGAAAGTTCTCGAGAACTTTCCACTTGTCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181316.4-1739s21c1
Sequence:CCGGCCACTACAGTTGACTTGTGATCTCGAGATCACAAGTCAACTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181316.4-3214s21c1
Sequence:CCGGCTTTAGTCACATGCGCTTATACTCGAGTATAAGCGCATGTGACTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181316.4-1274s1c1
Sequence:CCGGCATAACCACATGCTGCATATTCTCGAGAATATGCAGCATGTGGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181316.4-1964s21c1
Sequence:CCGGGCAAGCCACAAACTAACTATACTCGAGTATAGTTAGTTTGTGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181316.4-1189s21c1
Sequence:CCGGCATGAAGAAGCTCGGTTATAACTCGAGTTATAACCGAGCTTCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181316.4-449s21c1
Sequence:CCGGAGTGGGAACGGCCACGATAAACTCGAGTTTATCGTGGCCGTTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181316
VALIDATED
BBS9 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 9
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181316.3-2788s1c1
Sequence:CCGGGCTGTGTGATAGGTTAGCCAACTCGAGTTGGCTAACCTATCACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181316.3-3226s1c1
Sequence:CCGGCTTTAGTCACATGCGCTTATACTCGAGTATAAGCGCATGTGACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181316.3-3224s1c1
Sequence:CCGGGCCTTTAGTCACATGCGCTTACTCGAGTAAGCGCATGTGACTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181316.3-1751s1c1
Sequence:CCGGCCACTACAGTTGACTTGTGATCTCGAGATCACAAGTCAACTGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_181316.3-3225s1c1
Sequence:CCGGCCTTTAGTCACATGCGCTTATCTCGAGATAAGCGCATGTGACTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181316.3-1988s1c1
Sequence:CCGGCTAACTATAGACACCAACAAACTCGAGTTTGTTGGTGTCTATAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181316.3-957s1c1
Sequence:CCGGCTTGCAGACAAGTGGAAAGTTCTCGAGAACTTTCCACTTGTCTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181316.4-1739s21c1
Sequence:CCGGCCACTACAGTTGACTTGTGATCTCGAGATCACAAGTCAACTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181316.4-3214s21c1
Sequence:CCGGCTTTAGTCACATGCGCTTATACTCGAGTATAAGCGCATGTGACTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215917    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181316.4-1274s1c1
Sequence:CCGGCATAACCACATGCTGCATATTCTCGAGAATATGCAGCATGTGGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181316.4-1964s21c1
Sequence:CCGGGCAAGCCACAAACTAACTATACTCGAGTATAGTTAGTTTGTGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181316.4-1189s21c1
Sequence:CCGGCATGAAGAAGCTCGGTTATAACTCGAGTTATAACCGAGCTTCTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_181316.4-449s21c1
Sequence:CCGGAGTGGGAACGGCCACGATAAACTCGAGTTTATCGTGGCCGTTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198428
BBS9 MISSION shRNA Bacterial Glycerol Stock
Bardet-Biedl syndrome 9
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-1054s1c1
Sequence:CCGGCCCGTACAGATTCCTTCCTTACTCGAGTAAGGAAGGAATCTGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198428.1-3390s1c1
Sequence:CCGGCCTTTGGTCATCCATCTGCTACTCGAGTAGCAGATGGATGACCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-2739s1c1
Sequence:CCGGGCTATTCTGGAAGCGGCATTTCTCGAGAAATGCCGCTTCCAGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-1881s1c1
Sequence:CCGGCCATTAGAATTGACTTGTGATCTCGAGATCACAAGTCAATTCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198428.1-3057s1c1
Sequence:CCGGGTAGAACAAGACTCTACAGAACTCGAGTTCTGTAGAGTCTTGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198428.1-1505s1c1
Sequence:CCGGGCATGATTTAAAGGGAGTGATCTCGAGATCACTCCCTTTAAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198428.1-3402s1c1
Sequence:CCGGCATCTGCTAATAGTCACAGAACTCGAGTTCTGTGACTATTAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198428.1-2248s1c1
Sequence:CCGGCTCGAATTACTGTTCTTGCTTCTCGAGAAGCAAGAACAGTAATTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-2933s1c1
Sequence:CCGGGCTCTGCGATAGATTATCCAACTCGAGTTGGATAATCTATCGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-2897s1c1
Sequence:CCGGCAAAGACACAAGCCAACTGAACTCGAGTTCAGTTGGCTTGTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-895s1c1
Sequence:CCGGCCTGCAATATGACCTATGGATCTCGAGATCCATAGGTCATATTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198428.1-3216s1c1
Sequence:CCGGCCTCATGCCAAGCACAGATATCTCGAGATATCTGTGCTTGGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198428
BBS9 MISSION shRNA shRNA Plasmid DNA
Bardet-Biedl syndrome 9
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-1054s1c1
Sequence:CCGGCCCGTACAGATTCCTTCCTTACTCGAGTAAGGAAGGAATCTGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198428.1-3390s1c1
Sequence:CCGGCCTTTGGTCATCCATCTGCTACTCGAGTAGCAGATGGATGACCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-2739s1c1
Sequence:CCGGGCTATTCTGGAAGCGGCATTTCTCGAGAAATGCCGCTTCCAGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-1881s1c1
Sequence:CCGGCCATTAGAATTGACTTGTGATCTCGAGATCACAAGTCAATTCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198428.1-3057s1c1
Sequence:CCGGGTAGAACAAGACTCTACAGAACTCGAGTTCTGTAGAGTCTTGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198428.1-1505s1c1
Sequence:CCGGGCATGATTTAAAGGGAGTGATCTCGAGATCACTCCCTTTAAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198428.1-3402s1c1
Sequence:CCGGCATCTGCTAATAGTCACAGAACTCGAGTTCTGTGACTATTAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198428.1-2248s1c1
Sequence:CCGGCTCGAATTACTGTTCTTGCTTCTCGAGAAGCAAGAACAGTAATTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-2933s1c1
Sequence:CCGGGCTCTGCGATAGATTATCCAACTCGAGTTGGATAATCTATCGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-2897s1c1
Sequence:CCGGCAAAGACACAAGCCAACTGAACTCGAGTTCAGTTGGCTTGTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-895s1c1
Sequence:CCGGCCTGCAATATGACCTATGGATCTCGAGATCCATAGGTCATATTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198428.1-3216s1c1
Sequence:CCGGCCTCATGCCAAGCACAGATATCTCGAGATATCTGTGCTTGGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198428
BBS9 MISSION shRNA Lentiviral Transduction Particles
Bardet-Biedl syndrome 9
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-1054s1c1
Sequence:CCGGCCCGTACAGATTCCTTCCTTACTCGAGTAAGGAAGGAATCTGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166409    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198428.1-3390s1c1
Sequence:CCGGCCTTTGGTCATCCATCTGCTACTCGAGTAGCAGATGGATGACCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-2739s1c1
Sequence:CCGGGCTATTCTGGAAGCGGCATTTCTCGAGAAATGCCGCTTCCAGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-1881s1c1
Sequence:CCGGCCATTAGAATTGACTTGTGATCTCGAGATCACAAGTCAATTCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198428.1-3057s1c1
Sequence:CCGGGTAGAACAAGACTCTACAGAACTCGAGTTCTGTAGAGTCTTGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198428.1-1505s1c1
Sequence:CCGGGCATGATTTAAAGGGAGTGATCTCGAGATCACTCCCTTTAAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198428.1-3402s1c1
Sequence:CCGGCATCTGCTAATAGTCACAGAACTCGAGTTCTGTGACTATTAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198428.1-2248s1c1
Sequence:CCGGCTCGAATTACTGTTCTTGCTTCTCGAGAAGCAAGAACAGTAATTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-2933s1c1
Sequence:CCGGGCTCTGCGATAGATTATCCAACTCGAGTTGGATAATCTATCGCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-2897s1c1
Sequence:CCGGCAAAGACACAAGCCAACTGAACTCGAGTTCAGTTGGCTTGTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198428.1-895s1c1
Sequence:CCGGCCTGCAATATGACCTATGGATCTCGAGATCCATAGGTCATATTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198428.1-3216s1c1
Sequence:CCGGCCTCATGCCAAGCACAGATATCTCGAGATATCTGTGCTTGGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks