EMAIL THIS PAGE TO A FRIEND

BBX

bobby sox homolog (Drosophila)

Synonyms: ARTC1 HBP2 HSPC339 MDS001
Gene ID:
Mouse(70508) bobby sox homolog (Drosophila)
Rat(303970) bobby sox homolog (Drosophila)
naked mole-rat(101713155) bobby sox homolog (Drosophila)
domestic guinea pig(100723264) bobby sox homolog (Drosophila)
sheep(101115417) bobby sox homolog (Drosophila)
Domestic Rabbit(100354549) bobby sox homolog (Drosophila)
fruit fly(3772670) bobby sox
chicken(418407) bobby sox homolog (Drosophila)
cow(533187) bobby sox homolog (Drosophila)
Horse(100061782) bobby sox homolog (Drosophila)
domestic cat(101080566) bobby sox homolog (Drosophila)
dog(478551) bobby sox homolog (Drosophila)
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020235 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020235 Rosetta Predictions human pricing
NM_001079938 Rosetta Predictions rat pricing
NM_027444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099621 predicted 945
2 SASI_Hs02_00353190 predicted 871
3 SASI_Hs01_00099622 predicted 1410
4 SASI_Hs01_00099623 predicted 724
5 SASI_Hs01_00099624 predicted 1964
6 SASI_Hs01_00099625 predicted 2749
7 SASI_Hs01_00099626 predicted 1202
8 SASI_Hs01_00099627 predicted 1983
9 SASI_Hs01_00099628 predicted 2809
10 SASI_Hs01_00099629 predicted 1345
11 SASI_Hs01_00099630 predicted 2005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079938 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208329 predicted 384
2 SASI_Rn02_00208330 predicted 1011
3 SASI_Rn02_00208331 predicted 762
4 SASI_Rn02_00208332 predicted 1071
5 SASI_Rn02_00208333 predicted 2286
6 SASI_Rn02_00208334 predicted 522
7 SASI_Rn02_00208335 predicted 925
8 SASI_Rn02_00208336 predicted 775
9 SASI_Rn02_00208337 predicted 2225
10 SASI_Rn02_00208338 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131423 predicted 1349
2 SASI_Mm01_00131424 predicted 1780
3 SASI_Mm01_00131425 predicted 1692
4 SASI_Mm01_00131426 predicted 2065
5 SASI_Mm01_00131427 predicted 618
6 SASI_Mm01_00131429 predicted 2379
7 SASI_Mm01_00131430 predicted 1513
8 SASI_Mm02_00332197 predicted 2715
9 SASI_Mm01_00131431 predicted 1390
10 SASI_Mm02_00332198 predicted 853
11 SASI_Mm01_00131422 predicted 492
12 SASI_Mm01_00131428 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020235
BBX MISSION shRNA Bacterial Glycerol Stock
bobby sox homolog (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020235.5-717s21c1
Sequence:CCGGAGACATGGCCAAGGAGTATAACTCGAGTTATACTCCTTGGCCATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020235.5-1771s21c1
Sequence:CCGGGACATTGAGAGCGTCATATATCTCGAGATATATGACGCTCTCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-2433s1c1
Sequence:CCGGCCTGTTACATTTGACCGGAAACTCGAGTTTCCGGTCAAATGTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-1974s1c1
Sequence:CCGGCCTCCAGATTTCATTAGTATTCTCGAGAATACTAATGAAATCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-3019s1c1
Sequence:CCGGCGCAGGCTCCTGTACTTATTTCTCGAGAAATAAGTACAGGAGCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-1088s1c1
Sequence:CCGGCCACTCTGATGCTTCTACAAACTCGAGTTTGTAGAAGCATCAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-896s1c1
Sequence:CCGGGCCTCAGCTTAACTTTGGAATCTCGAGATTCCAAAGTTAAGCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020235
BBX MISSION shRNA shRNA Plasmid DNA
bobby sox homolog (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020235.5-717s21c1
Sequence:CCGGAGACATGGCCAAGGAGTATAACTCGAGTTATACTCCTTGGCCATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020235.5-1771s21c1
Sequence:CCGGGACATTGAGAGCGTCATATATCTCGAGATATATGACGCTCTCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-2433s1c1
Sequence:CCGGCCTGTTACATTTGACCGGAAACTCGAGTTTCCGGTCAAATGTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-1974s1c1
Sequence:CCGGCCTCCAGATTTCATTAGTATTCTCGAGAATACTAATGAAATCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-3019s1c1
Sequence:CCGGCGCAGGCTCCTGTACTTATTTCTCGAGAAATAAGTACAGGAGCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-1088s1c1
Sequence:CCGGCCACTCTGATGCTTCTACAAACTCGAGTTTGTAGAAGCATCAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-896s1c1
Sequence:CCGGGCCTCAGCTTAACTTTGGAATCTCGAGATTCCAAAGTTAAGCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020235
BBX MISSION shRNA Lentiviral Transduction Particles
bobby sox homolog (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020235.5-717s21c1
Sequence:CCGGAGACATGGCCAAGGAGTATAACTCGAGTTATACTCCTTGGCCATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020235.5-1771s21c1
Sequence:CCGGGACATTGAGAGCGTCATATATCTCGAGATATATGACGCTCTCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-2433s1c1
Sequence:CCGGCCTGTTACATTTGACCGGAAACTCGAGTTTCCGGTCAAATGTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-1974s1c1
Sequence:CCGGCCTCCAGATTTCATTAGTATTCTCGAGAATACTAATGAAATCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-3019s1c1
Sequence:CCGGCGCAGGCTCCTGTACTTATTTCTCGAGAAATAAGTACAGGAGCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-1088s1c1
Sequence:CCGGCCACTCTGATGCTTCTACAAACTCGAGTTTGTAGAAGCATCAGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020235.2-896s1c1
Sequence:CCGGGCCTCAGCTTAACTTTGGAATCTCGAGATTCCAAAGTTAAGCTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027444
VALIDATED
BBX MISSION shRNA Bacterial Glycerol Stock
bobby sox homolog (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027444.2-1575s21c1
Sequence:CCGGTGTGCCATCCTCACGGAATTACTCGAGTAATTCCGTGAGGATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027444.2-686s21c1
Sequence:CCGGGACATGGCCAAGGAGTATAAACTCGAGTTTATACTCCTTGGCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027444.2-3055s21c1
Sequence:CCGGTCTACCCTAGCCTTGTCTTTACTCGAGTAAAGACAAGGCTAGGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027444.2-972s21c1
Sequence:CCGGGGACTTGCAGGCCTGATATTTCTCGAGAAATATCAGGCCTGCAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027444.2-2459s21c1
Sequence:CCGGATGTCCTCAGAATCGACTAAACTCGAGTTTAGTCGATTCTGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027444.1-3181s1c1
Sequence:CCGGGCCCATGTGTTAGTTTCAGAACTCGAGTTCTGAAACTAACACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027444.1-1944s1c1
Sequence:CCGGCCTCCAGATTTCCTTAGCATTCTCGAGAATGCTAAGGAAATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027444.1-2400s1c1
Sequence:CCGGCCTATTACATTTGACCGGAAACTCGAGTTTCCGGTCAAATGTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027444.1-2401s1c1
Sequence:CCGGCTATTACATTTGACCGGAAATCTCGAGATTTCCGGTCAAATGTAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027444.1-624s1c1
Sequence:CCGGGCTACCAAGATACTAGCTGATCTCGAGATCAGCTAGTATCTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027444
VALIDATED
BBX MISSION shRNA shRNA Plasmid DNA
bobby sox homolog (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027444.2-1575s21c1
Sequence:CCGGTGTGCCATCCTCACGGAATTACTCGAGTAATTCCGTGAGGATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027444.2-686s21c1
Sequence:CCGGGACATGGCCAAGGAGTATAAACTCGAGTTTATACTCCTTGGCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027444.2-3055s21c1
Sequence:CCGGTCTACCCTAGCCTTGTCTTTACTCGAGTAAAGACAAGGCTAGGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027444.2-972s21c1
Sequence:CCGGGGACTTGCAGGCCTGATATTTCTCGAGAAATATCAGGCCTGCAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027444.2-2459s21c1
Sequence:CCGGATGTCCTCAGAATCGACTAAACTCGAGTTTAGTCGATTCTGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027444.1-3181s1c1
Sequence:CCGGGCCCATGTGTTAGTTTCAGAACTCGAGTTCTGAAACTAACACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027444.1-1944s1c1
Sequence:CCGGCCTCCAGATTTCCTTAGCATTCTCGAGAATGCTAAGGAAATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027444.1-2400s1c1
Sequence:CCGGCCTATTACATTTGACCGGAAACTCGAGTTTCCGGTCAAATGTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027444.1-2401s1c1
Sequence:CCGGCTATTACATTTGACCGGAAATCTCGAGATTTCCGGTCAAATGTAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027444.1-624s1c1
Sequence:CCGGGCTACCAAGATACTAGCTGATCTCGAGATCAGCTAGTATCTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027444
VALIDATED
BBX MISSION shRNA Lentiviral Transduction Particles
bobby sox homolog (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027444.2-1575s21c1
Sequence:CCGGTGTGCCATCCTCACGGAATTACTCGAGTAATTCCGTGAGGATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027444.2-686s21c1
Sequence:CCGGGACATGGCCAAGGAGTATAAACTCGAGTTTATACTCCTTGGCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027444.2-3055s21c1
Sequence:CCGGTCTACCCTAGCCTTGTCTTTACTCGAGTAAAGACAAGGCTAGGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027444.2-972s21c1
Sequence:CCGGGGACTTGCAGGCCTGATATTTCTCGAGAAATATCAGGCCTGCAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027444.2-2459s21c1
Sequence:CCGGATGTCCTCAGAATCGACTAAACTCGAGTTTAGTCGATTCTGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027444.1-3181s1c1
Sequence:CCGGGCCCATGTGTTAGTTTCAGAACTCGAGTTCTGAAACTAACACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027444.1-1944s1c1
Sequence:CCGGCCTCCAGATTTCCTTAGCATTCTCGAGAATGCTAAGGAAATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027444.1-2400s1c1
Sequence:CCGGCCTATTACATTTGACCGGAAACTCGAGTTTCCGGTCAAATGTAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027444.1-2401s1c1
Sequence:CCGGCTATTACATTTGACCGGAAATCTCGAGATTTCCGGTCAAATGTAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027444.1-624s1c1
Sequence:CCGGGCTACCAAGATACTAGCTGATCTCGAGATCAGCTAGTATCTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks