EMAIL THIS PAGE TO A FRIEND

BCAM

basal cell adhesion molecule (Lutheran blood group)

92 Gene Product Result for
Synonyms: AU CD239 LU MSK19
UniProtKB ID: P50895, A8MYF9, A9YWT5, A9YWT6, Q86VC7
Gene ID:
Human(4059) Summary: This gene encodes Lutheran blood group glycoprotein, a member of the immunoglobulin superfamily and a receptor for the extracellular matrix protein, laminin. The protein contains five extracellular immunoglobulin domains, a single transmembrane domain, and a short C-terminal cytoplasmic tail. This protein may play a role in epithelial cell cancer and in vaso-occlusion of red blood cells in sickle cell disease. Polymorphisms in this gene define some of the antigens in the Lutheran system and also the Auberger system. Inactivating variants of this gene result in the recessive Lutheran null phenotype, Lu(a-b-), of the Lutheran blood group. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Mouse(57278) basal cell adhesion molecule
Rat(78958) basal cell adhesion molecule (Lutheran blood group)
Zebrafish(767689) basal cell adhesion molecule (Lutheran blood group)
cow(282862) basal cell adhesion molecule (Lutheran blood group)
Horse(100070622) basal cell adhesion molecule (Lutheran blood group)
domestic cat(101095534) basal cell adhesion molecule (Lutheran blood group)
dog(484456) basal cell adhesion molecule (Lutheran blood group)
naked mole-rat(101715004) basal cell adhesion molecule (Lutheran blood group)
domestic guinea pig(100730324) basal cell adhesion molecule (Lutheran blood group)
sheep(101111740) basal cell adhesion molecule (Lutheran blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005581 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020486 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020486 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020486 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041151 MISSION® esiRNA esiRNA human BCAM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013257 Rosetta Predictions human pricing
NM_005581 Rosetta Predictions human pricing
NM_031752 Rosetta Predictions rat pricing
NM_020486 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033467 predicted 404
2 SASI_Hs01_00033468 predicted 1060
3 SASI_Hs01_00033469 predicted 1383
4 SASI_Hs01_00033470 predicted 1383
5 SASI_Hs01_00033471 predicted 1431
6 SASI_Hs02_00306337 predicted 507
7 SASI_Hs01_00033472 predicted 968
8 SASI_Hs02_00306338 predicted 1255
9 SASI_Hs01_00033473 predicted 459
10 SASI_Hs01_00033474 predicted 625
11 SASI_Hs01_00033466 predicted 1433
12 SASI_Hs01_00033475 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048161 predicted 404
2 SASI_Hs01_00048162 predicted 1063
3 SASI_Hs01_00048163 predicted 1379
4 SASI_Hs01_00048164 predicted 1385
5 SASI_Hs01_00048165 predicted 1433
6 SASI_Hs02_00339864 predicted 515
7 SASI_Hs01_00048166 predicted 969
8 SASI_Hs02_00339865 predicted 1263
9 SASI_Hs01_00048167 predicted 462
10 SASI_Hs01_00048168 predicted 626
11 SASI_Hs01_00048160 predicted 1440
12 SASI_Hs01_00048169 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095990 predicted 1560
2 SASI_Rn02_00265166 predicted 1031
3 SASI_Rn01_00095991 predicted 588
4 SASI_Rn01_00095992 predicted 238
5 SASI_Rn01_00095993 predicted 1209
6 SASI_Rn01_00095994 predicted 1221
7 SASI_Rn01_00095995 predicted 1094
8 SASI_Rn01_00095996 predicted 1644
9 SASI_Rn01_00095998 predicted 399
10 SASI_Rn01_00095999 predicted 1577
11 SASI_Rn01_00095997 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160488 predicted 639
2 SASI_Mm01_00160489 predicted 401
3 SASI_Mm01_00160490 predicted 1223
4 SASI_Mm01_00160491 predicted 1279
5 SASI_Mm01_00160492 predicted 1685
6 SASI_Mm01_00160493 predicted 451
7 SASI_Mm01_00160494 predicted 1349
8 SASI_Mm01_00160495 predicted 1217
9 SASI_Mm01_00160496 predicted 1624
10 SASI_Mm01_00160497 predicted 771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005581
BCAM MISSION shRNA Bacterial Glycerol Stock
basal cell adhesion molecule (Lutheran blood group)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005581.3-1919s21c1
Sequence:CCGGAGACGAGTGCTGAGCCAAGAACTCGAGTTCTTGGCTCAGCACTCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005581.3-1157s21c1
Sequence:CCGGGCTTTCCTTACCTCTAAACAGCTCGAGCTGTTTAGAGGTAAGGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005581.3-587s21c1
Sequence:CCGGCAAGATCACGTGGTATCGCAACTCGAGTTGCGATACCACGTGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-181s1c1
Sequence:CCGGACGACCATTATATGCTGGAATCTCGAGATTCCAGCATATAATGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-1348s1c1
Sequence:CCGGCAGAGCTAAAGACAGCGGAAACTCGAGTTTCCGCTGTCTTTAGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-1235s1c1
Sequence:CCGGGCTCAGTTCTATCACCTTCGACTCGAGTCGAAGGTGATAGAACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-134s1c1
Sequence:CCGGGATGCGAGGAAAGTCTGTCATCTCGAGATGACAGACTTTCCTCGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-1691s1c1
Sequence:CCGGCCTCGTCGTTGCTGTCTTCTACTCGAGTAGAAGACAGCAACGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005581
BCAM MISSION shRNA shRNA Plasmid DNA
basal cell adhesion molecule (Lutheran blood group)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005581.3-1919s21c1
Sequence:CCGGAGACGAGTGCTGAGCCAAGAACTCGAGTTCTTGGCTCAGCACTCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005581.3-1157s21c1
Sequence:CCGGGCTTTCCTTACCTCTAAACAGCTCGAGCTGTTTAGAGGTAAGGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005581.3-587s21c1
Sequence:CCGGCAAGATCACGTGGTATCGCAACTCGAGTTGCGATACCACGTGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-181s1c1
Sequence:CCGGACGACCATTATATGCTGGAATCTCGAGATTCCAGCATATAATGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-1348s1c1
Sequence:CCGGCAGAGCTAAAGACAGCGGAAACTCGAGTTTCCGCTGTCTTTAGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-1235s1c1
Sequence:CCGGGCTCAGTTCTATCACCTTCGACTCGAGTCGAAGGTGATAGAACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-134s1c1
Sequence:CCGGGATGCGAGGAAAGTCTGTCATCTCGAGATGACAGACTTTCCTCGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-1691s1c1
Sequence:CCGGCCTCGTCGTTGCTGTCTTCTACTCGAGTAGAAGACAGCAACGACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005581
BCAM MISSION shRNA Lentiviral Transduction Particles
basal cell adhesion molecule (Lutheran blood group)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005581.3-1919s21c1
Sequence:CCGGAGACGAGTGCTGAGCCAAGAACTCGAGTTCTTGGCTCAGCACTCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005581.3-1157s21c1
Sequence:CCGGGCTTTCCTTACCTCTAAACAGCTCGAGCTGTTTAGAGGTAAGGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005581.3-587s21c1
Sequence:CCGGCAAGATCACGTGGTATCGCAACTCGAGTTGCGATACCACGTGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-181s1c1
Sequence:CCGGACGACCATTATATGCTGGAATCTCGAGATTCCAGCATATAATGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-1348s1c1
Sequence:CCGGCAGAGCTAAAGACAGCGGAAACTCGAGTTTCCGCTGTCTTTAGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-1235s1c1
Sequence:CCGGGCTCAGTTCTATCACCTTCGACTCGAGTCGAAGGTGATAGAACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-134s1c1
Sequence:CCGGGATGCGAGGAAAGTCTGTCATCTCGAGATGACAGACTTTCCTCGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005581.2-1691s1c1
Sequence:CCGGCCTCGTCGTTGCTGTCTTCTACTCGAGTAGAAGACAGCAACGACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020486
VALIDATED
BCAM MISSION shRNA Bacterial Glycerol Stock
basal cell adhesion molecule (Lutheran blood group)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-2142s21c1
Sequence:CCGGGCCTTCCTCCAGGGAATGTAACTCGAGTTACATTCCCTGGAGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-1740s21c1
Sequence:CCGGGCTGCTTTCTATTGCATGAGACTCGAGTCTCATGCAATAGAAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-220s21c1
Sequence:CCGGCTGAGCATTACGTGCTGGAATCTCGAGATTCCAGCACGTAATGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-1083s21c1
Sequence:CCGGGTGCAACTTGTCAAGAAGCTACTCGAGTAGCTTCTTGACAAGTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-1604s21c1
Sequence:CCGGGTCCTGTGAAGCGTCTAACATCTCGAGATGTTAGACGCTTCACAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020486.1-1554s1c1
Sequence:CCGGGTCCTGTGAAGCGTCTAACATCTCGAGATGTTAGACGCTTCACAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020486.1-1033s1c1
Sequence:CCGGGTGCAACTTGTCAAGAAGCTACTCGAGTAGCTTCTTGACAAGTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020486.1-1690s1c1
Sequence:CCGGGCTGCTTTCTATTGCATGAGACTCGAGTCTCATGCAATAGAAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020486.1-170s1c1
Sequence:CCGGCTGAGCATTACGTGCTGGAATCTCGAGATTCCAGCACGTAATGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020486.1-2092s1c1
Sequence:CCGGGCCTTCCTCCAGGGAATGTAACTCGAGTTACATTCCCTGGAGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020486
VALIDATED
BCAM MISSION shRNA shRNA Plasmid DNA
basal cell adhesion molecule (Lutheran blood group)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-2142s21c1
Sequence:CCGGGCCTTCCTCCAGGGAATGTAACTCGAGTTACATTCCCTGGAGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-1740s21c1
Sequence:CCGGGCTGCTTTCTATTGCATGAGACTCGAGTCTCATGCAATAGAAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-220s21c1
Sequence:CCGGCTGAGCATTACGTGCTGGAATCTCGAGATTCCAGCACGTAATGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-1083s21c1
Sequence:CCGGGTGCAACTTGTCAAGAAGCTACTCGAGTAGCTTCTTGACAAGTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-1604s21c1
Sequence:CCGGGTCCTGTGAAGCGTCTAACATCTCGAGATGTTAGACGCTTCACAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020486.1-1554s1c1
Sequence:CCGGGTCCTGTGAAGCGTCTAACATCTCGAGATGTTAGACGCTTCACAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020486.1-1033s1c1
Sequence:CCGGGTGCAACTTGTCAAGAAGCTACTCGAGTAGCTTCTTGACAAGTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020486.1-1690s1c1
Sequence:CCGGGCTGCTTTCTATTGCATGAGACTCGAGTCTCATGCAATAGAAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020486.1-170s1c1
Sequence:CCGGCTGAGCATTACGTGCTGGAATCTCGAGATTCCAGCACGTAATGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020486.1-2092s1c1
Sequence:CCGGGCCTTCCTCCAGGGAATGTAACTCGAGTTACATTCCCTGGAGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020486
VALIDATED
BCAM MISSION shRNA Lentiviral Transduction Particles
basal cell adhesion molecule (Lutheran blood group)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-2142s21c1
Sequence:CCGGGCCTTCCTCCAGGGAATGTAACTCGAGTTACATTCCCTGGAGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-1740s21c1
Sequence:CCGGGCTGCTTTCTATTGCATGAGACTCGAGTCTCATGCAATAGAAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-220s21c1
Sequence:CCGGCTGAGCATTACGTGCTGGAATCTCGAGATTCCAGCACGTAATGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-1083s21c1
Sequence:CCGGGTGCAACTTGTCAAGAAGCTACTCGAGTAGCTTCTTGACAAGTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020486.2-1604s21c1
Sequence:CCGGGTCCTGTGAAGCGTCTAACATCTCGAGATGTTAGACGCTTCACAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020486.1-1554s1c1
Sequence:CCGGGTCCTGTGAAGCGTCTAACATCTCGAGATGTTAGACGCTTCACAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020486.1-1033s1c1
Sequence:CCGGGTGCAACTTGTCAAGAAGCTACTCGAGTAGCTTCTTGACAAGTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020486.1-1690s1c1
Sequence:CCGGGCTGCTTTCTATTGCATGAGACTCGAGTCTCATGCAATAGAAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020486.1-170s1c1
Sequence:CCGGCTGAGCATTACGTGCTGGAATCTCGAGATTCCAGCACGTAATGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020486.1-2092s1c1
Sequence:CCGGGCCTTCCTCCAGGGAATGTAACTCGAGTTACATTCCCTGGAGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)