EMAIL THIS PAGE TO A FRIEND

BCAN

brevican

116 Gene Product Result for
Synonyms: BEHAB CSPG7
Gene ID:
Human(63827) Summary: This gene encodes a member of the lectican family of chondroitin sulfate proteoglycans that is specifically expressed in the central nervous system. This protein is developmentally regulated and may function in the formation of the brain extracellular matrix. This protein is highly expressed in gliomas and may promote the growth and cell motility of brain tumor cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Mouse(12032) brevican
Rat(25393) brevican
sheep(101105963) brevican
dog(612102) brevican
cow(281019) brevican
Horse(100064356) brevican
chicken(425976) brevican
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407842 Anti-BCAN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA007865 Anti-BCAN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106167 Anti-BCAN antibody produced in rabbit affinity isolated antibody guinea pig, human, horse, rabbit
western blot pricing
SAB5200879 Monoclonal Anti-Brevican - Alkaline Phosphatase antibody produced in mouse clone S294A-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200880 Monoclonal Anti-Brevican - Apc antibody produced in mouse clone S294A-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200871 Monoclonal Anti-Brevican - Atto 390 antibody produced in mouse clone S294A-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200872 Monoclonal Anti-Brevican - Atto 488 antibody produced in mouse clone S294A-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200873 Monoclonal Anti-Brevican - Atto 565 antibody produced in mouse clone S294A-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200874 Monoclonal Anti-Brevican - Atto 594 antibody produced in mouse clone S294A-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200875 Monoclonal Anti-Brevican - Atto 633 antibody produced in mouse clone S294A-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200876 Monoclonal Anti-Brevican - Atto 655 antibody produced in mouse clone S294A-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200877 Monoclonal Anti-Brevican - Atto 680 antibody produced in mouse clone S294A-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200878 Monoclonal Anti-Brevican - Atto 700 antibody produced in mouse clone S294A-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200881 Monoclonal Anti-Brevican - Biotin antibody produced in mouse clone S294A-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200882 Monoclonal Anti-Brevican - Fitc antibody produced in mouse clone S294A-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200883 Monoclonal Anti-Brevican - Hrp antibody produced in mouse clone S294A-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200884 Monoclonal Anti-Brevican - Pe/Atto 594 antibody produced in mouse clone S294A-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200885 Monoclonal Anti-Brevican - Percp antibody produced in mouse clone S294A-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200886 Monoclonal Anti-Brevican - Rpe antibody produced in mouse clone S294A-6, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5200887 Monoclonal Anti-Brevican - Streptavidin antibody produced in mouse clone S294A-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5200870 Monoclonal Anti-Brevican antibody produced in mouse clone S294A-6, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021948 Rosetta Predictions human pricing
NM_198427 Rosetta Predictions human pricing
NM_001033665 Rosetta Predictions rat pricing
NM_012916 Rosetta Predictions rat pricing
NM_001109758 Rosetta Predictions mouse pricing
NM_007529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068759 predicted 832
2 SASI_Hs01_00068760 predicted 1062
3 SASI_Hs02_00355271 predicted 999
4 SASI_Hs02_00355272 predicted 1998
5 SASI_Hs01_00068761 predicted 958
6 SASI_Hs01_00068762 predicted 1060
7 SASI_Hs01_00068763 predicted 557
8 SASI_Hs01_00068764 predicted 717
9 SASI_Hs01_00068765 predicted 1302
10 SASI_Hs01_00068767 predicted 1094
11 SASI_Hs01_00068766 predicted 1081
12 SASI_Hs01_00068768 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086590 predicted 825
2 SASI_Hs01_00086591 predicted 1059
3 SASI_Hs02_00371939 predicted 1003
4 SASI_Hs02_00371940 predicted 2002
5 SASI_Hs01_00086592 predicted 958
6 SASI_Hs01_00086593 predicted 1052
7 SASI_Hs01_00086594 predicted 554
8 SASI_Hs01_00086595 predicted 721
9 SASI_Hs01_00086596 predicted 1302
10 SASI_Hs01_00086598 predicted 1090
11 SASI_Hs01_00086597 predicted 1087
12 SASI_Hs01_00086599 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075440 predicted 913
2 SASI_Rn02_00203663 predicted 2573
3 SASI_Rn02_00203664 predicted 601
4 SASI_Rn01_00075442 predicted 1117
5 SASI_Rn01_00075444 predicted 1121
6 SASI_Rn01_00075446 predicted 600
7 SASI_Rn01_00075447 predicted 1116
8 SASI_Rn01_00075448 predicted 1011
9 SASI_Rn02_00203665 predicted 2372
10 SASI_Rn02_00203666 predicted 602
11 SASI_Rn01_00075441 predicted 976
12 SASI_Rn01_00075443 predicted 1579
13 SASI_Rn01_00075445 predicted 996
14 SASI_Rn01_00075449 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090087 predicted 910
2 SASI_Rn01_00090088 predicted 975
3 SASI_Rn02_00260452 predicted 601
4 SASI_Rn01_00090089 predicted 1115
5 SASI_Rn01_00090091 predicted 1123
6 SASI_Rn01_00090092 predicted 995
7 SASI_Rn01_00090093 predicted 602
8 SASI_Rn01_00090094 predicted 1114
9 SASI_Rn01_00090095 predicted 1002
10 SASI_Rn02_00260453 predicted 606
11 SASI_Rn01_00090090 predicted 1572
12 SASI_Rn01_00090096 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304314 predicted 991
2 SASI_Mm02_00304315 predicted 842
3 SASI_Mm02_00304316 predicted 1711
4 SASI_Mm02_00304317 predicted 1302
5 SASI_Mm02_00304318 predicted 1592
6 SASI_Mm02_00304319 predicted 1615
7 SASI_Mm02_00304320 predicted 998
8 SASI_Mm02_00304321 predicted 1728
9 SASI_Mm02_00304322 predicted 685
10 SASI_Mm02_00304323 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311845 predicted 986
2 SASI_Mm02_00311846 predicted 848
3 SASI_Mm02_00311847 predicted 1705
4 SASI_Mm02_00311848 predicted 1303
5 SASI_Mm01_00168820 predicted 1587
6 SASI_Mm01_00168822 predicted 1611
7 SASI_Mm01_00168823 predicted 1003
8 SASI_Mm01_00168824 predicted 1735
9 SASI_Mm02_00311849 predicted 684
10 SASI_Mm02_00311850 predicted 635
11 SASI_Mm01_00168821 predicted 891
12 SASI_Mm01_00168825 predicted 2475
13 SASI_Mm01_00168826 predicted 2487
14 SASI_Mm01_00168827 predicted 2579
15 SASI_Mm01_00168828 predicted 2635
16 SASI_Mm01_00168829 predicted 2279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021948
BCAN MISSION shRNA Bacterial Glycerol Stock
brevican
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021948.3-721s1c1
Sequence:CCGGCCCAACGACTCAGGTATCTATCTCGAGATAGATACCTGAGTCGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021948.3-3298s1c1
Sequence:CCGGGTAAATCCCTAAGTGCCTCAACTCGAGTTGAGGCACTTAGGGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021948.3-1691s1c1
Sequence:CCGGCATTGGAGGAAGAAGAGAAATCTCGAGATTTCTCTTCTTCCTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021948.3-1720s1c1
Sequence:CCGGGAAGAAGAGAAAGAGGAGGAACTCGAGTTCCTCCTCTTTCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021948.3-1362s1c1
Sequence:CCGGCAATAAGCACAGCCGCTTCAACTCGAGTTGAAGCGGCTGTGCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021948.3-729s1c1
Sequence:CCGGCTCAGGTATCTATCGCTGTGACTCGAGTCACAGCGATAGATACCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021948.3-1618s1c1
Sequence:CCGGCCTAGGACGCTCCTAGAATTTCTCGAGAAATTCTAGGAGCGTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021948.3-3151s1c1
Sequence:CCGGCCACAGGAAGTGACAACATGACTCGAGTCATGTTGTCACTTCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021948.3-2700s21c1
Sequence:CCGGGTGGCATGATCAGGGACAATGCTCGAGCATTGTCCCTGATCATGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021948.3-1084s21c1
Sequence:CCGGTGTTATGCTGAAGACCTAAATCTCGAGATTTAGGTCTTCAGCATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021948.3-961s21c1
Sequence:CCGGTCGGATCAGACCGTGAGGTATCTCGAGATACCTCACGGTCTGATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021948
BCAN MISSION shRNA shRNA Plasmid DNA
brevican
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021948.3-721s1c1
Sequence:CCGGCCCAACGACTCAGGTATCTATCTCGAGATAGATACCTGAGTCGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021948.3-3298s1c1
Sequence:CCGGGTAAATCCCTAAGTGCCTCAACTCGAGTTGAGGCACTTAGGGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021948.3-1691s1c1
Sequence:CCGGCATTGGAGGAAGAAGAGAAATCTCGAGATTTCTCTTCTTCCTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021948.3-1720s1c1
Sequence:CCGGGAAGAAGAGAAAGAGGAGGAACTCGAGTTCCTCCTCTTTCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021948.3-1362s1c1
Sequence:CCGGCAATAAGCACAGCCGCTTCAACTCGAGTTGAAGCGGCTGTGCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021948.3-729s1c1
Sequence:CCGGCTCAGGTATCTATCGCTGTGACTCGAGTCACAGCGATAGATACCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021948.3-1618s1c1
Sequence:CCGGCCTAGGACGCTCCTAGAATTTCTCGAGAAATTCTAGGAGCGTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021948.3-3151s1c1
Sequence:CCGGCCACAGGAAGTGACAACATGACTCGAGTCATGTTGTCACTTCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021948.3-2700s21c1
Sequence:CCGGGTGGCATGATCAGGGACAATGCTCGAGCATTGTCCCTGATCATGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021948.3-1084s21c1
Sequence:CCGGTGTTATGCTGAAGACCTAAATCTCGAGATTTAGGTCTTCAGCATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021948.3-961s21c1
Sequence:CCGGTCGGATCAGACCGTGAGGTATCTCGAGATACCTCACGGTCTGATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021948
BCAN MISSION shRNA Lentiviral Transduction Particles
brevican
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021948.3-721s1c1
Sequence:CCGGCCCAACGACTCAGGTATCTATCTCGAGATAGATACCTGAGTCGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021948.3-3298s1c1
Sequence:CCGGGTAAATCCCTAAGTGCCTCAACTCGAGTTGAGGCACTTAGGGATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021948.3-1691s1c1
Sequence:CCGGCATTGGAGGAAGAAGAGAAATCTCGAGATTTCTCTTCTTCCTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021948.3-1720s1c1
Sequence:CCGGGAAGAAGAGAAAGAGGAGGAACTCGAGTTCCTCCTCTTTCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021948.3-1362s1c1
Sequence:CCGGCAATAAGCACAGCCGCTTCAACTCGAGTTGAAGCGGCTGTGCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021948.3-729s1c1
Sequence:CCGGCTCAGGTATCTATCGCTGTGACTCGAGTCACAGCGATAGATACCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021948.3-1618s1c1
Sequence:CCGGCCTAGGACGCTCCTAGAATTTCTCGAGAAATTCTAGGAGCGTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021948.3-3151s1c1
Sequence:CCGGCCACAGGAAGTGACAACATGACTCGAGTCATGTTGTCACTTCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021948.3-2700s21c1
Sequence:CCGGGTGGCATGATCAGGGACAATGCTCGAGCATTGTCCCTGATCATGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021948.3-1084s21c1
Sequence:CCGGTGTTATGCTGAAGACCTAAATCTCGAGATTTAGGTCTTCAGCATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021948.3-961s21c1
Sequence:CCGGTCGGATCAGACCGTGAGGTATCTCGAGATACCTCACGGTCTGATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007529
BCAN MISSION shRNA Bacterial Glycerol Stock
brevican
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000178378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007529.1-2266s1c1
Sequence:CCGGGAGGAGCAAGACTTTGTCAATCTCGAGATTGACAAAGTCTTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007529.1-903s1c1
Sequence:CCGGCGAAGACCTAAATGGAGAACTCTCGAGAGTTCTCCATTTAGGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007529.1-2985s1c1
Sequence:CCGGGTAAGTCCCTAAGTGCCTCAACTCGAGTTGAGGCACTTAGGGACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007529.1-438s1c1
Sequence:CCGGCGTCAAGGTAAACGAAGCCTACTCGAGTAGGCTTCGTTTACCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007529
BCAN MISSION shRNA shRNA Plasmid DNA
brevican
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000178378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007529.1-2266s1c1
Sequence:CCGGGAGGAGCAAGACTTTGTCAATCTCGAGATTGACAAAGTCTTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007529.1-903s1c1
Sequence:CCGGCGAAGACCTAAATGGAGAACTCTCGAGAGTTCTCCATTTAGGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007529.1-2985s1c1
Sequence:CCGGGTAAGTCCCTAAGTGCCTCAACTCGAGTTGAGGCACTTAGGGACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007529.1-438s1c1
Sequence:CCGGCGTCAAGGTAAACGAAGCCTACTCGAGTAGGCTTCGTTTACCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007529
BCAN MISSION shRNA Lentiviral Transduction Particles
brevican
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000178378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007529.1-2266s1c1
Sequence:CCGGGAGGAGCAAGACTTTGTCAATCTCGAGATTGACAAAGTCTTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007529.1-903s1c1
Sequence:CCGGCGAAGACCTAAATGGAGAACTCTCGAGAGTTCTCCATTTAGGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007529.1-2985s1c1
Sequence:CCGGGTAAGTCCCTAAGTGCCTCAACTCGAGTTGAGGCACTTAGGGACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007529.1-438s1c1
Sequence:CCGGCGTCAAGGTAAACGAAGCCTACTCGAGTAGGCTTCGTTTACCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks