EMAIL THIS PAGE TO A FRIEND

BCAP29

B-cell receptor-associated protein 29

283 Gene Product Result for
Synonyms: BAP29
UniProtKB ID: Q9UHQ4, G5E9L4, O95003
Gene ID:
Mouse(12033) B cell receptor associated protein 29
Rat(298943) B-cell receptor-associated protein 29
Zebrafish(554151) B-cell receptor-associated protein 29
cow(511018) B-cell receptor-associated protein 29
domestic cat(101080622) B-cell receptor-associated protein 29
chicken(417702) B-cell receptor-associated protein 29
dog(475884) B-cell receptor-associated protein 29
naked mole-rat(101703087) B-cell receptor-associated protein 29
domestic guinea pig(100718676) B-cell receptor-associated protein 29
sheep(101104394) B-cell receptor-associated protein 29
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018844 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008405 Rosetta Predictions human pricing
NM_001008406 Rosetta Predictions human pricing
NM_001008407 Rosetta Predictions human pricing
NM_018844 Rosetta Predictions human pricing
NM_001006980 Rosetta Predictions rat pricing
NM_007530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030822 predicted 218
2 SASI_Hs01_00030823 predicted 230
3 SASI_Hs01_00030824 predicted 210
4 SASI_Hs01_00030825 predicted 239
5 SASI_Hs01_00030826 predicted 263
6 SASI_Hs01_00030827 predicted 211
7 SASI_Hs01_00030828 predicted 205
8 SASI_Hs01_00030829 predicted 232
9 SASI_Hs01_00030830 predicted 217
10 SASI_Hs01_00030831 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088384 predicted 213
2 SASI_Hs01_00088385 predicted 232
3 SASI_Hs01_00088386 predicted 206
4 SASI_Hs01_00088387 predicted 246
5 SASI_Hs01_00088388 predicted 261
6 SASI_Hs01_00088389 predicted 209
7 SASI_Hs01_00088390 predicted 205
8 SASI_Hs01_00088391 predicted 240
9 SASI_Hs01_00088392 predicted 218
10 SASI_Hs01_00088393 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104898 predicted 210
2 SASI_Hs01_00104899 predicted 229
3 SASI_Hs01_00104900 predicted 205
4 SASI_Hs01_00104901 predicted 244
5 SASI_Hs01_00104902 predicted 260
6 SASI_Hs01_00104903 predicted 206
7 SASI_Hs01_00104904 predicted 199
8 SASI_Hs01_00104905 predicted 232
9 SASI_Hs01_00104906 predicted 210
10 SASI_Hs01_00104907 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115969 predicted 216
2 SASI_Hs01_00115970 predicted 233
3 SASI_Hs01_00115971 predicted 207
4 SASI_Hs01_00115972 predicted 244
5 SASI_Hs01_00115973 predicted 264
6 SASI_Hs01_00115974 predicted 208
7 SASI_Hs01_00115975 predicted 205
8 SASI_Hs01_00115976 predicted 241
9 SASI_Hs01_00115977 predicted 217
10 SASI_Hs01_00115978 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198548 predicted 747
2 SASI_Rn01_00106091 predicted 844
3 SASI_Rn01_00106092 predicted 836
4 SASI_Rn01_00106093 predicted 321
5 SASI_Rn01_00106094 predicted 691
6 SASI_Rn02_00198549 predicted 414
7 SASI_Rn01_00106095 predicted 208
8 SASI_Rn01_00106096 predicted 698
9 SASI_Rn01_00106097 predicted 308
10 SASI_Rn01_00106098 predicted 388
11 SASI_Rn01_00106090 predicted 477
12 SASI_Rn01_00106099 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081220 predicted 457
2 SASI_Mm01_00081221 predicted 562
3 SASI_Mm01_00081222 predicted 928
4 SASI_Mm01_00081224 predicted 1062
5 SASI_Mm01_00081225 predicted 436
6 SASI_Mm01_00081226 predicted 997
7 SASI_Mm01_00081227 predicted 611
8 SASI_Mm01_00081228 predicted 1067
9 SASI_Mm01_00081229 predicted 532
10 SASI_Mm02_00311851 predicted 466
11 SASI_Mm01_00081223 predicted 330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018844
VALIDATED
BCAP29 MISSION shRNA Bacterial Glycerol Stock
B-cell receptor-associated protein 29
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018844.3-486s21c1
Sequence:CCGGCAAGGCTTTCCTTACCATTATCTCGAGATAATGGTAAGGAAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018844.3-377s21c1
Sequence:CCGGATGCCGAAATAGGACTCATTTCTCGAGAAATGAGTCCTATTTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018844.3-692s21c1
Sequence:CCGGGACGTCTGGTTACGCTTATTACTCGAGTAATAAGCGTAACCAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018844.3-1153s21c1
Sequence:CCGGACTATGACCGGTTCGTAATTTCTCGAGAAATTACGAACCGGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018844.3-1179s21c1
Sequence:CCGGATGCCACACATAGGTTGTATTCTCGAGAATACAACCTATGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018844.3-1018s21c1
Sequence:CCGGTCTGAACTTCAGGATCGTTTACTCGAGTAAACGATCCTGAAGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018844.3-633s21c1
Sequence:CCGGTAGGTCTCAAAGAAATCTTTACTCGAGTAAAGATTTCTTTGAGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018844.3-732s21c1
Sequence:CCGGGTCAAACAAAGGTGTACTTAACTCGAGTTAAGTACACCTTTGTTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018844.1-440s1c1
Sequence:CCGGCGTTCAAACAAAGGTGTACTTCTCGAGAAGTACACCTTTGTTTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018844.1-414s1c1
Sequence:CCGGCGCTTATTACTCAACTGGCAACTCGAGTTGCCAGTTGAGTAATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018844.1-242s1c1
Sequence:CCGGGCTGTGAGAGAAGTAAGGAAACTCGAGTTTCCTTACTTCTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018844.1-713s1c1
Sequence:CCGGCTCCTGAAAGAACACTCTGAACTCGAGTTCAGAGTGTTCTTTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018844
VALIDATED
BCAP29 MISSION shRNA shRNA Plasmid DNA
B-cell receptor-associated protein 29
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018844.3-486s21c1
Sequence:CCGGCAAGGCTTTCCTTACCATTATCTCGAGATAATGGTAAGGAAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018844.3-377s21c1
Sequence:CCGGATGCCGAAATAGGACTCATTTCTCGAGAAATGAGTCCTATTTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018844.3-692s21c1
Sequence:CCGGGACGTCTGGTTACGCTTATTACTCGAGTAATAAGCGTAACCAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018844.3-1153s21c1
Sequence:CCGGACTATGACCGGTTCGTAATTTCTCGAGAAATTACGAACCGGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018844.3-1179s21c1
Sequence:CCGGATGCCACACATAGGTTGTATTCTCGAGAATACAACCTATGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018844.3-1018s21c1
Sequence:CCGGTCTGAACTTCAGGATCGTTTACTCGAGTAAACGATCCTGAAGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018844.3-633s21c1
Sequence:CCGGTAGGTCTCAAAGAAATCTTTACTCGAGTAAAGATTTCTTTGAGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018844.3-732s21c1
Sequence:CCGGGTCAAACAAAGGTGTACTTAACTCGAGTTAAGTACACCTTTGTTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018844.1-440s1c1
Sequence:CCGGCGTTCAAACAAAGGTGTACTTCTCGAGAAGTACACCTTTGTTTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018844.1-414s1c1
Sequence:CCGGCGCTTATTACTCAACTGGCAACTCGAGTTGCCAGTTGAGTAATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018844.1-242s1c1
Sequence:CCGGGCTGTGAGAGAAGTAAGGAAACTCGAGTTTCCTTACTTCTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018844.1-713s1c1
Sequence:CCGGCTCCTGAAAGAACACTCTGAACTCGAGTTCAGAGTGTTCTTTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018844
VALIDATED
BCAP29 MISSION shRNA Lentiviral Transduction Particles
B-cell receptor-associated protein 29
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018844.3-486s21c1
Sequence:CCGGCAAGGCTTTCCTTACCATTATCTCGAGATAATGGTAAGGAAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018844.3-377s21c1
Sequence:CCGGATGCCGAAATAGGACTCATTTCTCGAGAAATGAGTCCTATTTCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018844.3-692s21c1
Sequence:CCGGGACGTCTGGTTACGCTTATTACTCGAGTAATAAGCGTAACCAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018844.3-1153s21c1
Sequence:CCGGACTATGACCGGTTCGTAATTTCTCGAGAAATTACGAACCGGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018844.3-1179s21c1
Sequence:CCGGATGCCACACATAGGTTGTATTCTCGAGAATACAACCTATGTGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018844.3-1018s21c1
Sequence:CCGGTCTGAACTTCAGGATCGTTTACTCGAGTAAACGATCCTGAAGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018844.3-633s21c1
Sequence:CCGGTAGGTCTCAAAGAAATCTTTACTCGAGTAAAGATTTCTTTGAGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018844.3-732s21c1
Sequence:CCGGGTCAAACAAAGGTGTACTTAACTCGAGTTAAGTACACCTTTGTTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018844.1-440s1c1
Sequence:CCGGCGTTCAAACAAAGGTGTACTTCTCGAGAAGTACACCTTTGTTTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018844.1-414s1c1
Sequence:CCGGCGCTTATTACTCAACTGGCAACTCGAGTTGCCAGTTGAGTAATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018844.1-242s1c1
Sequence:CCGGGCTGTGAGAGAAGTAAGGAAACTCGAGTTTCCTTACTTCTCTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018844.1-713s1c1
Sequence:CCGGCTCCTGAAAGAACACTCTGAACTCGAGTTCAGAGTGTTCTTTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007530
VALIDATED
BCAP29 MISSION shRNA Bacterial Glycerol Stock
B-cell receptor-associated protein 29
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007530.2-930s21c1
Sequence:CCGGTCAGAACTTCAGAACCGTTTACTCGAGTAAACGGTTCTGAAGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007530.2-328s21c1
Sequence:CCGGCCTTTATTCCTCCACAGAGATCTCGAGATCTCTGTGGAGGAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007530.2-1515s21c1
Sequence:CCGGGCACTGTTGATAGTGTGTGTTCTCGAGAACACACACTATCAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007530.2-693s21c1
Sequence:CCGGGCTGCCAAGAAATTCATGGAACTCGAGTTCCATGAATTTCTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007530.2-527s21c1
Sequence:CCGGGCACACACAGATGAAGCTCTTCTCGAGAAGAGCTTCATCTGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-1515s1c1
Sequence:CCGGGCACTGTTGATAGTGTGTGTTCTCGAGAACACACACTATCAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-693s1c1
Sequence:CCGGGCTGCCAAGAAATTCATGGAACTCGAGTTCCATGAATTTCTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-930s1c1
Sequence:CCGGTCAGAACTTCAGAACCGTTTACTCGAGTAAACGGTTCTGAAGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-328s1c1
Sequence:CCGGCCTTTATTCCTCCACAGAGATCTCGAGATCTCTGTGGAGGAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-527s1c1
Sequence:CCGGGCACACACAGATGAAGCTCTTCTCGAGAAGAGCTTCATCTGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007530
VALIDATED
BCAP29 MISSION shRNA shRNA Plasmid DNA
B-cell receptor-associated protein 29
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007530.2-930s21c1
Sequence:CCGGTCAGAACTTCAGAACCGTTTACTCGAGTAAACGGTTCTGAAGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007530.2-328s21c1
Sequence:CCGGCCTTTATTCCTCCACAGAGATCTCGAGATCTCTGTGGAGGAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007530.2-1515s21c1
Sequence:CCGGGCACTGTTGATAGTGTGTGTTCTCGAGAACACACACTATCAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007530.2-693s21c1
Sequence:CCGGGCTGCCAAGAAATTCATGGAACTCGAGTTCCATGAATTTCTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007530.2-527s21c1
Sequence:CCGGGCACACACAGATGAAGCTCTTCTCGAGAAGAGCTTCATCTGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-1515s1c1
Sequence:CCGGGCACTGTTGATAGTGTGTGTTCTCGAGAACACACACTATCAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-693s1c1
Sequence:CCGGGCTGCCAAGAAATTCATGGAACTCGAGTTCCATGAATTTCTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-930s1c1
Sequence:CCGGTCAGAACTTCAGAACCGTTTACTCGAGTAAACGGTTCTGAAGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-328s1c1
Sequence:CCGGCCTTTATTCCTCCACAGAGATCTCGAGATCTCTGTGGAGGAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-527s1c1
Sequence:CCGGGCACACACAGATGAAGCTCTTCTCGAGAAGAGCTTCATCTGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007530
VALIDATED
BCAP29 MISSION shRNA Lentiviral Transduction Particles
B-cell receptor-associated protein 29
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007530.2-930s21c1
Sequence:CCGGTCAGAACTTCAGAACCGTTTACTCGAGTAAACGGTTCTGAAGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007530.2-328s21c1
Sequence:CCGGCCTTTATTCCTCCACAGAGATCTCGAGATCTCTGTGGAGGAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007530.2-1515s21c1
Sequence:CCGGGCACTGTTGATAGTGTGTGTTCTCGAGAACACACACTATCAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007530.2-693s21c1
Sequence:CCGGGCTGCCAAGAAATTCATGGAACTCGAGTTCCATGAATTTCTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007530.2-527s21c1
Sequence:CCGGGCACACACAGATGAAGCTCTTCTCGAGAAGAGCTTCATCTGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-1515s1c1
Sequence:CCGGGCACTGTTGATAGTGTGTGTTCTCGAGAACACACACTATCAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-693s1c1
Sequence:CCGGGCTGCCAAGAAATTCATGGAACTCGAGTTCCATGAATTTCTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-930s1c1
Sequence:CCGGTCAGAACTTCAGAACCGTTTACTCGAGTAAACGGTTCTGAAGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-328s1c1
Sequence:CCGGCCTTTATTCCTCCACAGAGATCTCGAGATCTCTGTGGAGGAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007530.2-527s1c1
Sequence:CCGGGCACACACAGATGAAGCTCTTCTCGAGAAGAGCTTCATCTGTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks