EMAIL THIS PAGE TO A FRIEND

BCAP31

B-cell receptor-associated protein 31

Synonyms: 6C6-AG BAP31 CDM DXS1357E
UniProtKB ID: P51572, B3KQ79, D3DWV5, Q13836, Q96CF0
Gene ID:
Human(10134) Summary: This gene encodes a member of the B-cell receptor associated protein 31 superfamily. The encoded protein is a multi-pass transmembrane protein of the endoplasmic reticulum that is involved in the anterograde transport of membrane proteins from the endoplasmic reticulum to the Golgi and in caspase 8-mediated apoptosis. Microdeletions in this gene are associated with contiguous ABCD1/DXS1375E deletion syndrome (CADDS), a neonatal disorder. Alternative splicing of this gene results in multiple transcript variants. Two related pseudogenes have been identified on chromosome 16. [provided by RefSeq, Jan 2012]
Mouse(27061) B cell receptor associated protein 31
Rat(293852) B-cell receptor-associated protein 31
sheep(101111605) B-cell receptor-associated protein 31
domestic guinea pig(100728003) B-cell receptor-associated protein 31
naked mole-rat(101719761) B-cell receptor-associated protein 31
Zebrafish(368488) B-cell receptor-associated protein 31
dog(481080) B-cell receptor-associated protein 31
cow(533949) B-cell receptor-associated protein 31
domestic cat(101081202) B-cell receptor-associated protein 31
chicken(100857815) B-cell receptor-associated protein 31
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012060 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012060 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012060 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005745 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005745 Rosetta Predictions human pricing
NM_001004224 Rosetta Predictions rat pricing
NM_012060 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230291 predicted 525
2 SASI_Hs01_00230292 predicted 200
3 SASI_Hs01_00230293 predicted 341
4 SASI_Hs01_00230294 predicted 685
5 SASI_Hs01_00230295 predicted 323
6 SASI_Hs01_00230296 predicted 558
7 SASI_Hs01_00230297 predicted 1063
8 SASI_Hs01_00230298 predicted 652
9 SASI_Hs01_00230299 predicted 467
10 SASI_Hs02_00340190 predicted 617
11 SASI_Hs01_00230300 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087446 predicted 844
2 SASI_Rn01_00087447 predicted 470
3 SASI_Rn01_00087448 predicted 722
4 SASI_Rn01_00087449 predicted 221
5 SASI_Rn01_00087450 predicted 217
6 SASI_Rn01_00087451 predicted 812
7 SASI_Rn01_00087452 predicted 632
8 SASI_Rn01_00087453 predicted 786
9 SASI_Rn01_00087454 predicted 202
10 SASI_Rn01_00087455 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145826 predicted 775
2 SASI_Mm01_00145827 predicted 646
3 SASI_Mm01_00145830 predicted 595
4 SASI_Mm01_00145831 predicted 305
5 SASI_Mm01_00145832 predicted 993
6 SASI_Mm01_00145833 predicted 299
7 SASI_Mm01_00145834 predicted 270
8 SASI_Mm01_00145835 predicted 981
9 SASI_Mm02_00322040 predicted 494
10 SASI_Mm02_00322041 predicted 785
11 SASI_Mm01_00145828 predicted 594
12 SASI_Mm01_00145829 predicted 840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012060
VALIDATED
BCAP31 MISSION shRNA Bacterial Glycerol Stock
B-cell receptor-associated protein 31
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012060.2-959s1c1
Sequence:CCGGCCATGGCTTATAGATCATTATCTCGAGATAATGATCTATAAGCCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012060.2-649s1c1
Sequence:CCGGCCTGAAGAATGACCTGAGGAACTCGAGTTCCTCAGGTCATTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012060.2-305s1c1
Sequence:CCGGCGAGAGATCCTGAAATACGATCTCGAGATCGTATTTCAGGATCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012060.2-494s1c1
Sequence:CCGGGCCTCCAATGAAGCCTTTAAACTCGAGTTTAAAGGCTTCATTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012060.2-398s1c1
Sequence:CCGGGCTCAGAGGAATCTCTATATTCTCGAGAATATAGAGATTCCTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-304s21c1
Sequence:CCGGCGAGAGATCCTGAAATACGATCTCGAGATCGTATTTCAGGATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-493s21c1
Sequence:CCGGGCCTCCAATGAAGCCTTTAAACTCGAGTTTAAAGGCTTCATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-648s21c1
Sequence:CCGGCCTGAAGAATGACCTGAGGAACTCGAGTTCCTCAGGTCATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-397s21c1
Sequence:CCGGGCTCAGAGGAATCTCTATATTCTCGAGAATATAGAGATTCCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-958s21c1
Sequence:CCGGCCATGGCTTATAGATCATTATCTCGAGATAATGATCTATAAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012060
VALIDATED
BCAP31 MISSION shRNA shRNA Plasmid DNA
B-cell receptor-associated protein 31
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012060.2-959s1c1
Sequence:CCGGCCATGGCTTATAGATCATTATCTCGAGATAATGATCTATAAGCCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012060.2-649s1c1
Sequence:CCGGCCTGAAGAATGACCTGAGGAACTCGAGTTCCTCAGGTCATTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012060.2-305s1c1
Sequence:CCGGCGAGAGATCCTGAAATACGATCTCGAGATCGTATTTCAGGATCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012060.2-494s1c1
Sequence:CCGGGCCTCCAATGAAGCCTTTAAACTCGAGTTTAAAGGCTTCATTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012060.2-398s1c1
Sequence:CCGGGCTCAGAGGAATCTCTATATTCTCGAGAATATAGAGATTCCTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-304s21c1
Sequence:CCGGCGAGAGATCCTGAAATACGATCTCGAGATCGTATTTCAGGATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-493s21c1
Sequence:CCGGGCCTCCAATGAAGCCTTTAAACTCGAGTTTAAAGGCTTCATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-648s21c1
Sequence:CCGGCCTGAAGAATGACCTGAGGAACTCGAGTTCCTCAGGTCATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-397s21c1
Sequence:CCGGGCTCAGAGGAATCTCTATATTCTCGAGAATATAGAGATTCCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-958s21c1
Sequence:CCGGCCATGGCTTATAGATCATTATCTCGAGATAATGATCTATAAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012060
VALIDATED
BCAP31 MISSION shRNA Lentiviral Transduction Particles
B-cell receptor-associated protein 31
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012060.2-959s1c1
Sequence:CCGGCCATGGCTTATAGATCATTATCTCGAGATAATGATCTATAAGCCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012060.2-649s1c1
Sequence:CCGGCCTGAAGAATGACCTGAGGAACTCGAGTTCCTCAGGTCATTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012060.2-305s1c1
Sequence:CCGGCGAGAGATCCTGAAATACGATCTCGAGATCGTATTTCAGGATCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012060.2-494s1c1
Sequence:CCGGGCCTCCAATGAAGCCTTTAAACTCGAGTTTAAAGGCTTCATTGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012060.2-398s1c1
Sequence:CCGGGCTCAGAGGAATCTCTATATTCTCGAGAATATAGAGATTCCTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-304s21c1
Sequence:CCGGCGAGAGATCCTGAAATACGATCTCGAGATCGTATTTCAGGATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-493s21c1
Sequence:CCGGGCCTCCAATGAAGCCTTTAAACTCGAGTTTAAAGGCTTCATTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-648s21c1
Sequence:CCGGCCTGAAGAATGACCTGAGGAACTCGAGTTCCTCAGGTCATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-397s21c1
Sequence:CCGGGCTCAGAGGAATCTCTATATTCTCGAGAATATAGAGATTCCTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012060.4-958s21c1
Sequence:CCGGCCATGGCTTATAGATCATTATCTCGAGATAATGATCTATAAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005745
VALIDATED
BCAP31 MISSION shRNA Bacterial Glycerol Stock
B-cell receptor-associated protein 31
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005745.5-439s1c1
Sequence:CCGGGAATCTCTACATTGCTGGCTTCTCGAGAAGCCAGCAATGTAGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005745.5-856s1c1
Sequence:CCGGCATGGACAAGAAGGAAGAGTACTCGAGTACTCTTCCTTCTTGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005745.7-364s21c1
Sequence:CCGGCCTATGGCAACACCTTCTTTGCTCGAGCAAAGAAGGTGTTGCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005745.7-417s21c1
Sequence:CCGGATCGATGCCGTGCGCGAAATTCTCGAGAATTTCGCGCACGGCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005745.7-1160s21c1
Sequence:CCGGTACACGTTCAGAATGCGTTTGCTCGAGCAAACGCATTCTGAACGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005745.7-577s21c1
Sequence:CCGGGACGCCTGGTGACTCTCATTTCTCGAGAAATGAGAGTCACCAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005745.7-259s21c1
Sequence:CCGGTCCTCTATGCGGAGGTCTTTGCTCGAGCAAAGACCTCCGCATAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005745
VALIDATED
BCAP31 MISSION shRNA shRNA Plasmid DNA
B-cell receptor-associated protein 31
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005745.5-439s1c1
Sequence:CCGGGAATCTCTACATTGCTGGCTTCTCGAGAAGCCAGCAATGTAGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005745.5-856s1c1
Sequence:CCGGCATGGACAAGAAGGAAGAGTACTCGAGTACTCTTCCTTCTTGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005745.7-364s21c1
Sequence:CCGGCCTATGGCAACACCTTCTTTGCTCGAGCAAAGAAGGTGTTGCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005745.7-417s21c1
Sequence:CCGGATCGATGCCGTGCGCGAAATTCTCGAGAATTTCGCGCACGGCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005745.7-1160s21c1
Sequence:CCGGTACACGTTCAGAATGCGTTTGCTCGAGCAAACGCATTCTGAACGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005745.7-577s21c1
Sequence:CCGGGACGCCTGGTGACTCTCATTTCTCGAGAAATGAGAGTCACCAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005745.7-259s21c1
Sequence:CCGGTCCTCTATGCGGAGGTCTTTGCTCGAGCAAAGACCTCCGCATAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005745
VALIDATED
BCAP31 MISSION shRNA Lentiviral Transduction Particles
B-cell receptor-associated protein 31
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005745.5-439s1c1
Sequence:CCGGGAATCTCTACATTGCTGGCTTCTCGAGAAGCCAGCAATGTAGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005745.5-856s1c1
Sequence:CCGGCATGGACAAGAAGGAAGAGTACTCGAGTACTCTTCCTTCTTGTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005745.7-364s21c1
Sequence:CCGGCCTATGGCAACACCTTCTTTGCTCGAGCAAAGAAGGTGTTGCCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005745.7-417s21c1
Sequence:CCGGATCGATGCCGTGCGCGAAATTCTCGAGAATTTCGCGCACGGCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242712    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005745.7-1160s21c1
Sequence:CCGGTACACGTTCAGAATGCGTTTGCTCGAGCAAACGCATTCTGAACGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005745.7-577s21c1
Sequence:CCGGGACGCCTGGTGACTCTCATTTCTCGAGAAATGAGAGTCACCAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005745.7-259s21c1
Sequence:CCGGTCCTCTATGCGGAGGTCTTTGCTCGAGCAAAGACCTCCGCATAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks