EMAIL THIS PAGE TO A FRIEND

BCAR1

breast cancer anti-estrogen resistance 1

72 Gene Product Result for
Synonyms: CAS CAS1 CASS1 CRKAS P130Cas
Gene ID:
Human(9564) Summary: BCAR1, or CAS, is an Src (MIM 190090) family kinase substrate involved in various cellular events, including migration, survival, transformation, and invasion (Sawada et al., 2006 [PubMed 17129785]
Mouse(12927) breast cancer anti-estrogen resistance 1
Rat(25414) breast cancer anti-estrogen resistance 1
Zebrafish(568309) breast cancer anti-estrogen resistance 1
cow(527550) breast cancer anti-estrogen resistance 1
domestic cat(101096625) breast cancer anti-estrogen resistance 1
dog(479648) breast cancer anti-estrogen resistance 1
chicken(415691) breast cancer anti-estrogen resistance 1
naked mole-rat(101709701) breast cancer anti-estrogen resistance 1
domestic guinea pig(100713475) breast cancer anti-estrogen resistance 1
sheep(101117693) breast cancer anti-estrogen resistance 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406846 Anti-BCAR1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1401483 Anti-BCAR1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA042282 Anti-BCAR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse
immunohistochemistry, western blot pricing
SAB4503669 Anti-p130 CAS antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4503670 Anti-p130 CAS antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
C0354 Anti-p130CAS antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human, mouse
immunoprecipitation, microarray, western blot pricing
SAB4504048 Anti-phospho-p130 Cas (pTyr165) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504049 Anti-phospho-p130 Cas (pTyr249) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4503824 Anti-phospho-p130 Cas (pTyr410) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301231 Anti-phospho-p130 Cas (pTyr410) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4100301 Monoclonal Anti-BCAR1 antibody produced in mouse clone BCAR1-A255, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014567 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014567 Rosetta Predictions human pricing
NM_012931 Rosetta Predictions rat pricing
NM_009954 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184840 predicted 2107
2 SASI_Hs02_00345830 predicted 2366
3 SASI_Hs01_00184841 predicted 2180
4 SASI_Hs01_00184842 predicted 297
5 SASI_Hs01_00184843 predicted 2060
6 SASI_Hs01_00184844 predicted 2061
7 SASI_Hs01_00184845 predicted 1131
8 SASI_Hs01_00184847 predicted 1313
9 SASI_Hs01_00184849 predicted 2429
10 SASI_Hs02_00345831 predicted 1018
11 SASI_Hs01_00184846 predicted 1038
12 SASI_Hs01_00184848 predicted 2671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012931 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121495 predicted 1101
2 SASI_Rn02_00260477 predicted 2206
3 SASI_Rn01_00121497 predicted 1529
4 SASI_Rn01_00121498 predicted 2755
5 SASI_Rn01_00121499 predicted 256
6 SASI_Rn01_00121500 predicted 2648
7 SASI_Rn02_00260478 predicted 1239
8 SASI_Rn01_00121501 predicted 2030
9 SASI_Rn01_00121502 predicted 2296
10 SASI_Rn02_00260479 predicted 283
11 SASI_Rn01_00121496 predicted 1235
12 SASI_Rn01_00121503 predicted 898
13 SASI_Rn01_00121504 predicted 2566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194589 predicted 2787
2 SASI_Mm01_00194590 predicted 2663
3 SASI_Mm01_00194591 predicted 798
4 SASI_Mm01_00194592 predicted 2666
5 SASI_Mm01_00194594 predicted 683
6 SASI_Mm01_00194595 predicted 1886
7 SASI_Mm02_00317516 predicted 2508
8 SASI_Mm01_00194596 predicted 2558
9 SASI_Mm01_00194597 predicted 2860
10 SASI_Mm01_00194598 predicted 1719
11 SASI_Mm01_00194593 predicted 2442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014567
VALIDATED
BCAR1 MISSION shRNA Bacterial Glycerol Stock
breast cancer anti-estrogen resistance 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-173s21c1
Sequence:CCGGAGCGCTCTATGACAATGTGGCCTCGAGGCCACATTGTCATAGAGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-2679s21c1
Sequence:CCGGGACATGGTGGAGAGGGTCAAGCTCGAGCTTGACCCTCTCCACCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-1112s21c1
Sequence:CCGGGCGTGAGGAGACCTACGATGTCTCGAGACATCGTAGGTCTCCTCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-338s21c1
Sequence:CCGGGGGCATGTATGATAAGAAGCCCTCGAGGGCTTCTTATCATACATGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-2125s21c1
Sequence:CCGGGGATGGAGGACTATGACTACGCTCGAGCGTAGTCATAGTCCTCCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-2473s21c1
Sequence:CCGGAGATCTTTGTGGCGCACAGCACTCGAGTGCTGTGCGCCACAAAGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014567.2-2870s1c1
Sequence:CCGGCCCAGGAATCTGTATATATTTCTCGAGAAATATATACAGATTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014567.2-855s1c1
Sequence:CCGGGCCACAGGACATCTATGATGTCTCGAGACATCATAGATGTCCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014567.2-2624s1c1
Sequence:CCGGCCTTGCAGTACCCATCGCCTTCTCGAGAAGGCGATGGGTACTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014567.2-1332s1c1
Sequence:CCGGCGTGGTCGACAGTGGTGTGTACTCGAGTACACACCACTGTCGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014567.2-2223s1c1
Sequence:CCGGGCTGAAGCAGTTTGAACGACTCTCGAGAGTCGTTCAAACTGCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014567
VALIDATED
BCAR1 MISSION shRNA shRNA Plasmid DNA
breast cancer anti-estrogen resistance 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-173s21c1
Sequence:CCGGAGCGCTCTATGACAATGTGGCCTCGAGGCCACATTGTCATAGAGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-2679s21c1
Sequence:CCGGGACATGGTGGAGAGGGTCAAGCTCGAGCTTGACCCTCTCCACCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-1112s21c1
Sequence:CCGGGCGTGAGGAGACCTACGATGTCTCGAGACATCGTAGGTCTCCTCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-338s21c1
Sequence:CCGGGGGCATGTATGATAAGAAGCCCTCGAGGGCTTCTTATCATACATGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-2125s21c1
Sequence:CCGGGGATGGAGGACTATGACTACGCTCGAGCGTAGTCATAGTCCTCCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-2473s21c1
Sequence:CCGGAGATCTTTGTGGCGCACAGCACTCGAGTGCTGTGCGCCACAAAGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014567.2-2870s1c1
Sequence:CCGGCCCAGGAATCTGTATATATTTCTCGAGAAATATATACAGATTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014567.2-855s1c1
Sequence:CCGGGCCACAGGACATCTATGATGTCTCGAGACATCATAGATGTCCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014567.2-2624s1c1
Sequence:CCGGCCTTGCAGTACCCATCGCCTTCTCGAGAAGGCGATGGGTACTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014567.2-1332s1c1
Sequence:CCGGCGTGGTCGACAGTGGTGTGTACTCGAGTACACACCACTGTCGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014567.2-2223s1c1
Sequence:CCGGGCTGAAGCAGTTTGAACGACTCTCGAGAGTCGTTCAAACTGCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014567
VALIDATED
BCAR1 MISSION shRNA Lentiviral Transduction Particles
breast cancer anti-estrogen resistance 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-173s21c1
Sequence:CCGGAGCGCTCTATGACAATGTGGCCTCGAGGCCACATTGTCATAGAGCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-2679s21c1
Sequence:CCGGGACATGGTGGAGAGGGTCAAGCTCGAGCTTGACCCTCTCCACCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-1112s21c1
Sequence:CCGGGCGTGAGGAGACCTACGATGTCTCGAGACATCGTAGGTCTCCTCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-338s21c1
Sequence:CCGGGGGCATGTATGATAAGAAGCCCTCGAGGGCTTCTTATCATACATGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-2125s21c1
Sequence:CCGGGGATGGAGGACTATGACTACGCTCGAGCGTAGTCATAGTCCTCCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014567.3-2473s21c1
Sequence:CCGGAGATCTTTGTGGCGCACAGCACTCGAGTGCTGTGCGCCACAAAGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014567.2-2870s1c1
Sequence:CCGGCCCAGGAATCTGTATATATTTCTCGAGAAATATATACAGATTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014567.2-855s1c1
Sequence:CCGGGCCACAGGACATCTATGATGTCTCGAGACATCATAGATGTCCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014567.2-2624s1c1
Sequence:CCGGCCTTGCAGTACCCATCGCCTTCTCGAGAAGGCGATGGGTACTGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014567.2-1332s1c1
Sequence:CCGGCGTGGTCGACAGTGGTGTGTACTCGAGTACACACCACTGTCGACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014567.2-2223s1c1
Sequence:CCGGGCTGAAGCAGTTTGAACGACTCTCGAGAGTCGTTCAAACTGCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009954
VALIDATED
BCAR1 MISSION shRNA Bacterial Glycerol Stock
breast cancer anti-estrogen resistance 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009954.2-2788s21c1
Sequence:CCGGCCAGCATTCATTCCTCTTGAACTCGAGTTCAAGAGGAATGAATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009954.2-1087s21c1
Sequence:CCGGGCGTGAGGAAACCTATGATGTCTCGAGACATCATAGGTTTCCTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009954.2-286s21c1
Sequence:CCGGCCTCAAGATTCTGGTTGGCATCTCGAGATGCCAACCAGAATCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009954.2-2436s21c1
Sequence:CCGGACCAACCACCCAAGATCTTTGCTCGAGCAAAGATCTTGGGTGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009954.2-1087s1c1
Sequence:CCGGGCGTGAGGAAACCTATGATGTCTCGAGACATCATAGGTTTCCTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009954.2-1088s1c1
Sequence:CCGGCGTGAGGAAACCTATGATGTACTCGAGTACATCATAGGTTTCCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009954.2-286s1c1
Sequence:CCGGCCTCAAGATTCTGGTTGGCATCTCGAGATGCCAACCAGAATCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009954.2-1032s1c1
Sequence:CCGGCGGTGTATGATGTTCCTCCTTCTCGAGAAGGAGGAACATCATACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009954.2-2788s1c1
Sequence:CCGGCCAGCATTCATTCCTCTTGAACTCGAGTTCAAGAGGAATGAATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009954
VALIDATED
BCAR1 MISSION shRNA shRNA Plasmid DNA
breast cancer anti-estrogen resistance 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009954.2-2788s21c1
Sequence:CCGGCCAGCATTCATTCCTCTTGAACTCGAGTTCAAGAGGAATGAATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009954.2-1087s21c1
Sequence:CCGGGCGTGAGGAAACCTATGATGTCTCGAGACATCATAGGTTTCCTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009954.2-286s21c1
Sequence:CCGGCCTCAAGATTCTGGTTGGCATCTCGAGATGCCAACCAGAATCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009954.2-2436s21c1
Sequence:CCGGACCAACCACCCAAGATCTTTGCTCGAGCAAAGATCTTGGGTGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009954.2-1087s1c1
Sequence:CCGGGCGTGAGGAAACCTATGATGTCTCGAGACATCATAGGTTTCCTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009954.2-1088s1c1
Sequence:CCGGCGTGAGGAAACCTATGATGTACTCGAGTACATCATAGGTTTCCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009954.2-286s1c1
Sequence:CCGGCCTCAAGATTCTGGTTGGCATCTCGAGATGCCAACCAGAATCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009954.2-1032s1c1
Sequence:CCGGCGGTGTATGATGTTCCTCCTTCTCGAGAAGGAGGAACATCATACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009954.2-2788s1c1
Sequence:CCGGCCAGCATTCATTCCTCTTGAACTCGAGTTCAAGAGGAATGAATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009954
VALIDATED
BCAR1 MISSION shRNA Lentiviral Transduction Particles
breast cancer anti-estrogen resistance 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009954.2-2788s21c1
Sequence:CCGGCCAGCATTCATTCCTCTTGAACTCGAGTTCAAGAGGAATGAATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009954.2-1087s21c1
Sequence:CCGGGCGTGAGGAAACCTATGATGTCTCGAGACATCATAGGTTTCCTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009954.2-286s21c1
Sequence:CCGGCCTCAAGATTCTGGTTGGCATCTCGAGATGCCAACCAGAATCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009954.2-2436s21c1
Sequence:CCGGACCAACCACCCAAGATCTTTGCTCGAGCAAAGATCTTGGGTGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009954.2-1087s1c1
Sequence:CCGGGCGTGAGGAAACCTATGATGTCTCGAGACATCATAGGTTTCCTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009954.2-1088s1c1
Sequence:CCGGCGTGAGGAAACCTATGATGTACTCGAGTACATCATAGGTTTCCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009954.2-286s1c1
Sequence:CCGGCCTCAAGATTCTGGTTGGCATCTCGAGATGCCAACCAGAATCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009954.2-1032s1c1
Sequence:CCGGCGGTGTATGATGTTCCTCCTTCTCGAGAAGGAGGAACATCATACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009954.2-2788s1c1
Sequence:CCGGCCAGCATTCATTCCTCTTGAACTCGAGTTCAAGAGGAATGAATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)