EMAIL THIS PAGE TO A FRIEND

BCAR3

breast cancer anti-estrogen resistance 3

77 Gene Product Result for
Synonyms: NSP2 SH2D3B
UniProtKB ID: O75815, D3DT43, Q5TEW3, Q6UW40, Q9BR50
Gene ID:
Human(8412) Summary: Breast tumors are initially dependent on estrogens for growth and progression and can be inhibited by anti-estrogens such as tamoxifen. However, breast cancers progress to become anti-estrogen resistant. Breast cancer anti-estrogen resistance gene 3 was identified in the search for genes involved in the development of estrogen resistance. The gene encodes a component of intracellular signal transduction that causes estrogen-independent proliferation in human breast cancer cells. The protein contains a putative src homology 2 (SH2) domain, a hall mark of cellular tyrosine kinase signaling molecules, and is partly homologous to the cell division cycle protein CDC48. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Mouse(29815) breast cancer anti-estrogen resistance 3
Rat(310838) breast cancer anti-estrogen resistance 3
sheep(101106808) breast cancer anti-estrogen resistance 3
Domestic Rabbit(100352424) breast cancer anti-estrogen resistance 3
domestic guinea pig(100717989) breast cancer anti-estrogen resistance 3
naked mole-rat(101704053) breast cancer anti-estrogen resistance 3
Zebrafish(570610) breast cancer anti-estrogen resistance 3
dog(479941) breast cancer anti-estrogen resistance 3
domestic cat(101099315) breast cancer anti-estrogen resistance 3
cow(506231) breast cancer anti-estrogen resistance 3
Horse(100059015) breast cancer anti-estrogen resistance 3
chicken(424494) breast cancer anti-estrogen resistance 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003567 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003567 Rosetta Predictions human pricing
NM_001107722 Rosetta Predictions rat pricing
NM_013867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236261 predicted 2813
2 SASI_Hs02_00335873 predicted 1833
3 SASI_Hs01_00236262 predicted 755
4 SASI_Hs01_00236263 predicted 2446
5 SASI_Hs01_00236264 predicted 2193
6 SASI_Hs01_00236265 predicted 750
7 SASI_Hs01_00236266 predicted 813
8 SASI_Hs01_00236267 predicted 2451
9 SASI_Hs01_00236268 predicted 429
10 SASI_Hs01_00236269 predicted 2204
11 SASI_Hs01_00236270 predicted 2682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231625 predicted 1969
2 SASI_Rn02_00231626 predicted 1335
3 SASI_Rn02_00231627 predicted 2813
4 SASI_Rn02_00231628 predicted 2471
5 SASI_Rn02_00231629 predicted 453
6 SASI_Rn02_00231630 predicted 2991
7 SASI_Rn02_00231631 predicted 2556
8 SASI_Rn02_00231632 predicted 2010
9 SASI_Rn02_00231633 predicted 1014
10 SASI_Rn02_00231634 predicted 2353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022975 predicted 1896
2 SASI_Mm02_00322884 predicted 2742
3 SASI_Mm01_00022976 predicted 2394
4 SASI_Mm01_00022978 predicted 2668
5 SASI_Mm01_00022979 predicted 2320
6 SASI_Mm01_00022980 predicted 1487
7 SASI_Mm01_00022981 predicted 928
8 SASI_Mm01_00022982 predicted 2549
9 SASI_Mm01_00022983 predicted 1329
10 SASI_Mm01_00022984 predicted 911
11 SASI_Mm01_00022977 predicted 2617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013867
BCAR3 MISSION shRNA Bacterial Glycerol Stock
breast cancer anti-estrogen resistance 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013867.1-2644s1c1
Sequence:CCGGGCAGATTTCCAACCAGATGAACTCGAGTTCATCTGGTTGGAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013867.1-2871s1c1
Sequence:CCGGGCCTGTCAACTCTAAGTAATACTCGAGTATTACTTAGAGTTGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013867.1-996s1c1
Sequence:CCGGCCAATTCGAGATGGAGAGCTTCTCGAGAAGCTCTCCATCTCGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013867.1-2921s21c1
Sequence:CCGGTAACATCCACAGGATAGTAAACTCGAGTTTACTATCCTGTGGATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013867.1-1123s21c1
Sequence:CCGGTGGTGTCTGGAGGAGCGTTATCTCGAGATAACGCTCCTCCAGACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013867.1-484s21c1
Sequence:CCGGGCCTATCAAGACGTGTCTATACTCGAGTATAGACACGTCTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013867.1-2731s21c1
Sequence:CCGGGTCAACCAGAACGAGAGATACCTCGAGGTATCTCTCGTTCTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013867.1-2092s21c1
Sequence:CCGGGGGTTGGAGCTCATTACTTTACTCGAGTAAAGTAATGAGCTCCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013867
BCAR3 MISSION shRNA shRNA Plasmid DNA
breast cancer anti-estrogen resistance 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013867.1-2644s1c1
Sequence:CCGGGCAGATTTCCAACCAGATGAACTCGAGTTCATCTGGTTGGAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013867.1-2871s1c1
Sequence:CCGGGCCTGTCAACTCTAAGTAATACTCGAGTATTACTTAGAGTTGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013867.1-996s1c1
Sequence:CCGGCCAATTCGAGATGGAGAGCTTCTCGAGAAGCTCTCCATCTCGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013867.1-2921s21c1
Sequence:CCGGTAACATCCACAGGATAGTAAACTCGAGTTTACTATCCTGTGGATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013867.1-1123s21c1
Sequence:CCGGTGGTGTCTGGAGGAGCGTTATCTCGAGATAACGCTCCTCCAGACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013867.1-484s21c1
Sequence:CCGGGCCTATCAAGACGTGTCTATACTCGAGTATAGACACGTCTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013867.1-2731s21c1
Sequence:CCGGGTCAACCAGAACGAGAGATACCTCGAGGTATCTCTCGTTCTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013867.1-2092s21c1
Sequence:CCGGGGGTTGGAGCTCATTACTTTACTCGAGTAAAGTAATGAGCTCCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013867
BCAR3 MISSION shRNA Lentiviral Transduction Particles
breast cancer anti-estrogen resistance 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013867.1-2644s1c1
Sequence:CCGGGCAGATTTCCAACCAGATGAACTCGAGTTCATCTGGTTGGAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013867.1-2871s1c1
Sequence:CCGGGCCTGTCAACTCTAAGTAATACTCGAGTATTACTTAGAGTTGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013867.1-996s1c1
Sequence:CCGGCCAATTCGAGATGGAGAGCTTCTCGAGAAGCTCTCCATCTCGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013867.1-2921s21c1
Sequence:CCGGTAACATCCACAGGATAGTAAACTCGAGTTTACTATCCTGTGGATGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013867.1-1123s21c1
Sequence:CCGGTGGTGTCTGGAGGAGCGTTATCTCGAGATAACGCTCCTCCAGACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013867.1-484s21c1
Sequence:CCGGGCCTATCAAGACGTGTCTATACTCGAGTATAGACACGTCTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013867.1-2731s21c1
Sequence:CCGGGTCAACCAGAACGAGAGATACCTCGAGGTATCTCTCGTTCTGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013867.1-2092s21c1
Sequence:CCGGGGGTTGGAGCTCATTACTTTACTCGAGTAAAGTAATGAGCTCCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003567
BCAR3 MISSION shRNA Bacterial Glycerol Stock
breast cancer anti-estrogen resistance 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-181s1c1
Sequence:CCGGGCCTATCAAGATGTGTCTATACTCGAGTATAGACACATCTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-1608s1c1
Sequence:CCGGGCCCAACGAGTTTGAGTCAAACTCGAGTTTGACTCAAACTCGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-1653s1c1
Sequence:CCGGCCTGGAAACAGCAATGTTGAACTCGAGTTCAACATTGCTGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-2397s1c1
Sequence:CCGGGACTGAATTTCAAATGCGATTCTCGAGAATCGCATTTGAAATTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-568s1c1
Sequence:CCGGCGAGATGGTGACTTCCTAGTTCTCGAGAACTAGGAAGTCACCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-2063s21c1
Sequence:CCGGTCGGCATTGCAGTGGACATTCCTCGAGGAATGTCCACTGCAATGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-272s21c1
Sequence:CCGGCCAGAAACATGCCGGTGAATCCTCGAGGATTCACCGGCATGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-2666s21c1
Sequence:CCGGTAACTGCCCTCTCGCGTAAATCTCGAGATTTACGCGAGAGGGCAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003567.2-2837s21c1
Sequence:CCGGTAGTATCCACAGGATATTAAACTCGAGTTTAATATCCTGTGGATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-574s21c1
Sequence:CCGGCTGGACCCAACTGTGGAATATCTCGAGATATTCCACAGTTGGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-2374s21c1
Sequence:CCGGATGCCGCTTGTGACGTTAATGCTCGAGCATTAACGTCACAAGCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003567.2-2933s21c1
Sequence:CCGGATTAAGGTAACTACTGCTAATCTCGAGATTAGCAGTAGTTACCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-2025s21c1
Sequence:CCGGGCGCCTGGACATAATTGAAAGCTCGAGCTTTCAATTATGTCCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003567
BCAR3 MISSION shRNA shRNA Plasmid DNA
breast cancer anti-estrogen resistance 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-181s1c1
Sequence:CCGGGCCTATCAAGATGTGTCTATACTCGAGTATAGACACATCTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-1608s1c1
Sequence:CCGGGCCCAACGAGTTTGAGTCAAACTCGAGTTTGACTCAAACTCGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-1653s1c1
Sequence:CCGGCCTGGAAACAGCAATGTTGAACTCGAGTTCAACATTGCTGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-2397s1c1
Sequence:CCGGGACTGAATTTCAAATGCGATTCTCGAGAATCGCATTTGAAATTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-568s1c1
Sequence:CCGGCGAGATGGTGACTTCCTAGTTCTCGAGAACTAGGAAGTCACCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-2063s21c1
Sequence:CCGGTCGGCATTGCAGTGGACATTCCTCGAGGAATGTCCACTGCAATGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-272s21c1
Sequence:CCGGCCAGAAACATGCCGGTGAATCCTCGAGGATTCACCGGCATGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-2666s21c1
Sequence:CCGGTAACTGCCCTCTCGCGTAAATCTCGAGATTTACGCGAGAGGGCAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003567.2-2837s21c1
Sequence:CCGGTAGTATCCACAGGATATTAAACTCGAGTTTAATATCCTGTGGATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-574s21c1
Sequence:CCGGCTGGACCCAACTGTGGAATATCTCGAGATATTCCACAGTTGGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-2374s21c1
Sequence:CCGGATGCCGCTTGTGACGTTAATGCTCGAGCATTAACGTCACAAGCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003567.2-2933s21c1
Sequence:CCGGATTAAGGTAACTACTGCTAATCTCGAGATTAGCAGTAGTTACCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-2025s21c1
Sequence:CCGGGCGCCTGGACATAATTGAAAGCTCGAGCTTTCAATTATGTCCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003567
BCAR3 MISSION shRNA Lentiviral Transduction Particles
breast cancer anti-estrogen resistance 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-181s1c1
Sequence:CCGGGCCTATCAAGATGTGTCTATACTCGAGTATAGACACATCTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-1608s1c1
Sequence:CCGGGCCCAACGAGTTTGAGTCAAACTCGAGTTTGACTCAAACTCGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-1653s1c1
Sequence:CCGGCCTGGAAACAGCAATGTTGAACTCGAGTTCAACATTGCTGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-2397s1c1
Sequence:CCGGGACTGAATTTCAAATGCGATTCTCGAGAATCGCATTTGAAATTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003567.1-568s1c1
Sequence:CCGGCGAGATGGTGACTTCCTAGTTCTCGAGAACTAGGAAGTCACCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-2063s21c1
Sequence:CCGGTCGGCATTGCAGTGGACATTCCTCGAGGAATGTCCACTGCAATGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-272s21c1
Sequence:CCGGCCAGAAACATGCCGGTGAATCCTCGAGGATTCACCGGCATGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-2666s21c1
Sequence:CCGGTAACTGCCCTCTCGCGTAAATCTCGAGATTTACGCGAGAGGGCAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003567.2-2837s21c1
Sequence:CCGGTAGTATCCACAGGATATTAAACTCGAGTTTAATATCCTGTGGATACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-574s21c1
Sequence:CCGGCTGGACCCAACTGTGGAATATCTCGAGATATTCCACAGTTGGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-2374s21c1
Sequence:CCGGATGCCGCTTGTGACGTTAATGCTCGAGCATTAACGTCACAAGCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003567.2-2933s21c1
Sequence:CCGGATTAAGGTAACTACTGCTAATCTCGAGATTAGCAGTAGTTACCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003567.2-2025s21c1
Sequence:CCGGGCGCCTGGACATAATTGAAAGCTCGAGCTTTCAATTATGTCCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks