EMAIL THIS PAGE TO A FRIEND

BCAS1

breast carcinoma amplified sequence 1

76 Gene Product Result for
Synonyms: AIBC1 NABC1
UniProtKB ID: O75363, A0AVG5, Q68CZ3
Gene ID:
Human(8537) Summary: This gene resides in a region at 20q13 which is amplified in a variety of tumor types and associated with more aggressive tumor phenotypes. Among the genes identified from this region, it was found to be highly expressed in three amplified breast cancer cell lines and in one breast tumor without amplification at 20q13.2. However, this gene is not in the common region of maximal amplification and its expression was not detected in the breast cancer cell line MCF7, in which this region is highly amplified. Although not consistently expressed, this gene is a candidate oncogene. [provided by RefSeq, Jul 2008]
Mouse(76960) breast carcinoma amplified sequence 1
Rat(246755) breast carcinoma amplified sequence 1
chicken(419338) breast carcinoma amplified sequence 1
cow(504895) breast carcinoma amplified sequence 1
domestic cat(101095645) breast carcinoma amplified sequence 1
dog(611661) breast carcinoma amplified sequence 1
naked mole-rat(101717707) breast carcinoma amplified sequence 1
domestic guinea pig(100721486) breast carcinoma amplified sequence 1
sheep(101102166) breast carcinoma amplified sequence 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003657 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037631 MISSION® esiRNA esiRNA human BCAS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003657 Rosetta Predictions human pricing
NM_145670 Rosetta Predictions rat pricing
NM_029815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151138 predicted 1656
2 SASI_Hs01_00151139 predicted 1330
3 SASI_Hs01_00151141 predicted 1808
4 SASI_Hs01_00151142 predicted 444
5 SASI_Hs01_00151143 predicted 1835
6 SASI_Hs01_00151144 predicted 1445
7 SASI_Hs01_00151145 predicted 498
8 SASI_Hs01_00151146 predicted 943
9 SASI_Hs01_00151147 predicted 965
10 SASI_Hs02_00336034 predicted 1793
11 SASI_Hs01_00151140 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268702 predicted 1214
2 SASI_Rn02_00268703 predicted 838
3 SASI_Rn02_00268704 predicted 1272
4 SASI_Rn02_00268705 predicted 752
5 SASI_Rn01_00104822 predicted 1136
6 SASI_Rn02_00268706 predicted 845
7 SASI_Rn01_00104823 predicted 1501
8 SASI_Rn02_00268707 predicted 590
9 SASI_Rn01_00104825 predicted 871
10 SASI_Rn02_00268708 predicted 916
11 SASI_Rn01_00104818 predicted 650
12 SASI_Rn01_00104819 predicted 561
13 SASI_Rn01_00104820 predicted 601
14 SASI_Rn01_00104821 predicted 526
15 SASI_Rn01_00104824 predicted 841
16 SASI_Rn01_00104826 predicted 963
17 SASI_Rn01_00104827 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084848 predicted 968
2 SASI_Mm01_00084849 predicted 429
3 SASI_Mm01_00084850 predicted 1131
4 SASI_Mm01_00084851 predicted 1355
5 SASI_Mm01_00084852 predicted 1440
6 SASI_Mm01_00084853 predicted 243
7 SASI_Mm01_00084854 predicted 1452
8 SASI_Mm01_00084856 predicted 962
9 SASI_Mm01_00084857 predicted 674
10 SASI_Mm02_00335989 predicted 1157
11 SASI_Mm01_00084855 predicted 1548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003657
BCAS1 MISSION shRNA Bacterial Glycerol Stock
breast carcinoma amplified sequence 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003657.2-492s21c1
Sequence:CCGGATAAGTGTCAAGACGGATAATCTCGAGATTATCCGTCTTGACACTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003657.2-2074s21c1
Sequence:CCGGCAGTTGGCAAATCCAAGTAAACTCGAGTTTACTTGGATTTGCCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003657.2-1303s21c1
Sequence:GTACCGGAGTCAGACAAAGCCAACTTTACTCGAGTAAAGTTGGCTTTGTCTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003657.2-2235s21c1
Sequence:CCGGGTTGTATATTGAGGTGTATTACTCGAGTAATACACCTCAATATACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003657.2-1532s21c1
Sequence:CCGGGTCACCAGTAGAGATTATAAACTCGAGTTTATAATCTCTACTGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003657.1-774s1c1
Sequence:CCGGGCATCAAGACAAGGTGGATGACTCGAGTCATCCACCTTGTCTTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003657.1-2137s1c1
Sequence:CCGGGAGGGAATAGAGGAATGTGTTCTCGAGAACACATTCCTCTATTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003657.1-342s1c1
Sequence:CCGGCAACGGAAAGAATCTTGGGAACTCGAGTTCCCAAGATTCTTTCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003657.1-2011s1c1
Sequence:CCGGGCTGTTGTATATTGAGGTGTACTCGAGTACACCTCAATATACAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003657.1-1353s1c1
Sequence:CCGGCTTACAAACAGTGGACCTCAACTCGAGTTGAGGTCCACTGTTTGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003657.1-1072s1c1
Sequence:CCGGGCTGACCTTAAGTCAGACAAACTCGAGTTTGTCTGACTTAAGGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003657.1-1427s1c1
Sequence:CCGGGCAAACCAAGAACCTCTCTGACTCGAGTCAGAGAGGTTCTTGGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003657.1-702s1c1
Sequence:CCGGCAAATTCTTCAAGCTGGACAACTCGAGTTGTCCAGCTTGAAGAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003657.1-1307s1c1
Sequence:CCGGGTGAGTCACCAGTAGAGATTACTCGAGTAATCTCTACTGGTGACTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003657
BCAS1 MISSION shRNA shRNA Plasmid DNA
breast carcinoma amplified sequence 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003657.2-492s21c1
Sequence:CCGGATAAGTGTCAAGACGGATAATCTCGAGATTATCCGTCTTGACACTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003657.2-2074s21c1
Sequence:CCGGCAGTTGGCAAATCCAAGTAAACTCGAGTTTACTTGGATTTGCCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003657.2-1303s21c1
Sequence:GTACCGGAGTCAGACAAAGCCAACTTTACTCGAGTAAAGTTGGCTTTGTCTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003657.2-2235s21c1
Sequence:CCGGGTTGTATATTGAGGTGTATTACTCGAGTAATACACCTCAATATACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003657.2-1532s21c1
Sequence:CCGGGTCACCAGTAGAGATTATAAACTCGAGTTTATAATCTCTACTGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003657.1-774s1c1
Sequence:CCGGGCATCAAGACAAGGTGGATGACTCGAGTCATCCACCTTGTCTTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003657.1-2137s1c1
Sequence:CCGGGAGGGAATAGAGGAATGTGTTCTCGAGAACACATTCCTCTATTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003657.1-342s1c1
Sequence:CCGGCAACGGAAAGAATCTTGGGAACTCGAGTTCCCAAGATTCTTTCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003657.1-2011s1c1
Sequence:CCGGGCTGTTGTATATTGAGGTGTACTCGAGTACACCTCAATATACAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003657.1-1353s1c1
Sequence:CCGGCTTACAAACAGTGGACCTCAACTCGAGTTGAGGTCCACTGTTTGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003657.1-1072s1c1
Sequence:CCGGGCTGACCTTAAGTCAGACAAACTCGAGTTTGTCTGACTTAAGGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003657.1-1427s1c1
Sequence:CCGGGCAAACCAAGAACCTCTCTGACTCGAGTCAGAGAGGTTCTTGGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003657.1-702s1c1
Sequence:CCGGCAAATTCTTCAAGCTGGACAACTCGAGTTGTCCAGCTTGAAGAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003657.1-1307s1c1
Sequence:CCGGGTGAGTCACCAGTAGAGATTACTCGAGTAATCTCTACTGGTGACTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003657
BCAS1 MISSION shRNA Lentiviral Transduction Particles
breast carcinoma amplified sequence 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003657.2-492s21c1
Sequence:CCGGATAAGTGTCAAGACGGATAATCTCGAGATTATCCGTCTTGACACTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003657.2-2074s21c1
Sequence:CCGGCAGTTGGCAAATCCAAGTAAACTCGAGTTTACTTGGATTTGCCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003657.2-1303s21c1
Sequence:GTACCGGAGTCAGACAAAGCCAACTTTACTCGAGTAAAGTTGGCTTTGTCTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003657.2-2235s21c1
Sequence:CCGGGTTGTATATTGAGGTGTATTACTCGAGTAATACACCTCAATATACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003657.2-1532s21c1
Sequence:CCGGGTCACCAGTAGAGATTATAAACTCGAGTTTATAATCTCTACTGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003657.1-774s1c1
Sequence:CCGGGCATCAAGACAAGGTGGATGACTCGAGTCATCCACCTTGTCTTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003657.1-2137s1c1
Sequence:CCGGGAGGGAATAGAGGAATGTGTTCTCGAGAACACATTCCTCTATTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003657.1-342s1c1
Sequence:CCGGCAACGGAAAGAATCTTGGGAACTCGAGTTCCCAAGATTCTTTCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129875    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003657.1-2011s1c1
Sequence:CCGGGCTGTTGTATATTGAGGTGTACTCGAGTACACCTCAATATACAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003657.1-1353s1c1
Sequence:CCGGCTTACAAACAGTGGACCTCAACTCGAGTTGAGGTCCACTGTTTGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003657.1-1072s1c1
Sequence:CCGGGCTGACCTTAAGTCAGACAAACTCGAGTTTGTCTGACTTAAGGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003657.1-1427s1c1
Sequence:CCGGGCAAACCAAGAACCTCTCTGACTCGAGTCAGAGAGGTTCTTGGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003657.1-702s1c1
Sequence:CCGGCAAATTCTTCAAGCTGGACAACTCGAGTTGTCCAGCTTGAAGAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003657.1-1307s1c1
Sequence:CCGGGTGAGTCACCAGTAGAGATTACTCGAGTAATCTCTACTGGTGACTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029815
BCAS1 MISSION shRNA Bacterial Glycerol Stock
breast carcinoma amplified sequence 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029815.1-1599s1c1
Sequence:CCGGCGGAAGAAAGTAACGTGAAAGCTCGAGCTTTCACGTTACTTTCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029815.1-1546s1c1
Sequence:CCGGGATGGCGTTTCTCAGACAAATCTCGAGATTTGTCTGAGAAACGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029815.1-1117s1c1
Sequence:CCGGGCTAGGACTCTCCTTTAGAAACTCGAGTTTCTAAAGGAGAGTCCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029815.1-211s1c1
Sequence:CCGGCACTCGTGTAATTCAACACTACTCGAGTAGTGTTGAATTACACGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029815.1-261s1c1
Sequence:CCGGCCAAGGATAATGTGGCTACTTCTCGAGAAGTAGCCACATTATCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029815.1-2486s1c1
Sequence:CCGGGCTGTAAAGAAGAATGGGCAACTCGAGTTGCCCATTCTTCTTTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029815.1-2100s1c1
Sequence:CCGGGCCTACAACTTCAACCTGAATCTCGAGATTCAGGTTGAAGTTGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029815.1-1442s1c1
Sequence:CCGGGAAGTAGAATCCAGCTTACAACTCGAGTTGTAAGCTGGATTCTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029815
BCAS1 MISSION shRNA shRNA Plasmid DNA
breast carcinoma amplified sequence 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029815.1-1599s1c1
Sequence:CCGGCGGAAGAAAGTAACGTGAAAGCTCGAGCTTTCACGTTACTTTCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029815.1-1546s1c1
Sequence:CCGGGATGGCGTTTCTCAGACAAATCTCGAGATTTGTCTGAGAAACGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029815.1-1117s1c1
Sequence:CCGGGCTAGGACTCTCCTTTAGAAACTCGAGTTTCTAAAGGAGAGTCCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029815.1-211s1c1
Sequence:CCGGCACTCGTGTAATTCAACACTACTCGAGTAGTGTTGAATTACACGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029815.1-261s1c1
Sequence:CCGGCCAAGGATAATGTGGCTACTTCTCGAGAAGTAGCCACATTATCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029815.1-2486s1c1
Sequence:CCGGGCTGTAAAGAAGAATGGGCAACTCGAGTTGCCCATTCTTCTTTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029815.1-2100s1c1
Sequence:CCGGGCCTACAACTTCAACCTGAATCTCGAGATTCAGGTTGAAGTTGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029815.1-1442s1c1
Sequence:CCGGGAAGTAGAATCCAGCTTACAACTCGAGTTGTAAGCTGGATTCTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029815
BCAS1 MISSION shRNA Lentiviral Transduction Particles
breast carcinoma amplified sequence 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029815.1-1599s1c1
Sequence:CCGGCGGAAGAAAGTAACGTGAAAGCTCGAGCTTTCACGTTACTTTCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029815.1-1546s1c1
Sequence:CCGGGATGGCGTTTCTCAGACAAATCTCGAGATTTGTCTGAGAAACGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029815.1-1117s1c1
Sequence:CCGGGCTAGGACTCTCCTTTAGAAACTCGAGTTTCTAAAGGAGAGTCCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029815.1-211s1c1
Sequence:CCGGCACTCGTGTAATTCAACACTACTCGAGTAGTGTTGAATTACACGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029815.1-261s1c1
Sequence:CCGGCCAAGGATAATGTGGCTACTTCTCGAGAAGTAGCCACATTATCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029815.1-2486s1c1
Sequence:CCGGGCTGTAAAGAAGAATGGGCAACTCGAGTTGCCCATTCTTCTTTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029815.1-2100s1c1
Sequence:CCGGGCCTACAACTTCAACCTGAATCTCGAGATTCAGGTTGAAGTTGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029815.1-1442s1c1
Sequence:CCGGGAAGTAGAATCCAGCTTACAACTCGAGTTGTAAGCTGGATTCTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)