EMAIL THIS PAGE TO A FRIEND

BCAS2

breast carcinoma amplified sequence 2

60 Gene Product Result for
Synonyms: DAM1 SPF27 Snt309
UniProtKB ID: O75934, Q6FGS0
Gene ID:
Mouse(68183) breast carcinoma amplified sequence 2
Rat(295334) breast carcinoma amplified sequence 2
domestic guinea pig(100720302) breast carcinoma amplified sequence 2
naked mole-rat(101718582) breast carcinoma amplified sequence 2
Zebrafish(493614) breast carcinoma amplified sequence 2
chicken(419884) breast carcinoma amplified sequence 2
cow(507944) breast carcinoma amplified sequence 2
domestic cat(101097382) breast carcinoma amplified sequence 2
dog(475805) breast carcinoma amplified sequence 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005872 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005872 Rosetta Predictions human pricing
NM_001106458 Rosetta Predictions rat pricing
NM_026602 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054562 predicted 556
2 SASI_Hs01_00054563 predicted 499
3 SASI_Hs01_00054564 predicted 440
4 SASI_Hs01_00054565 predicted 273
5 SASI_Hs01_00054566 predicted 386
6 SASI_Hs01_00054567 predicted 389
7 SASI_Hs01_00054568 predicted 828
8 SASI_Hs01_00054569 predicted 417
9 SASI_Hs01_00054570 predicted 615
10 SASI_Hs01_00054571 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219158 predicted 494
2 SASI_Rn02_00219159 predicted 321
3 SASI_Rn02_00219160 predicted 515
4 SASI_Rn02_00219161 predicted 543
5 SASI_Rn02_00219162 predicted 402
6 SASI_Rn02_00219163 predicted 247
7 SASI_Rn02_00219164 predicted 590
8 SASI_Rn02_00219165 predicted 254
9 SASI_Rn02_00219166 predicted 320
10 SASI_Rn02_00219167 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097205 predicted 455
2 SASI_Mm01_00097206 predicted 563
3 SASI_Mm02_00330564 predicted 515
4 SASI_Mm01_00097207 predicted 279
5 SASI_Mm01_00097208 predicted 288
6 SASI_Mm01_00097209 predicted 441
7 SASI_Mm01_00097210 predicted 227
8 SASI_Mm01_00097212 predicted 225
9 SASI_Mm01_00097213 predicted 502
10 SASI_Mm01_00097214 predicted 490
11 SASI_Mm01_00097211 predicted 507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026602
VALIDATED
BCAS2 MISSION shRNA Bacterial Glycerol Stock
breast carcinoma amplified sequence 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026602.2-817s1c1
Sequence:CCGGCCATGGACTATGTAAACTGTTCTCGAGAACAGTTTACATAGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026602.2-229s1c1
Sequence:CCGGCGGATTATTCTGCCTTTGAAACTCGAGTTTCAAAGGCAGAATAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026602.2-285s1c1
Sequence:CCGGGCTCGACAACCGATTGAATTACTCGAGTAATTCAATCGGTTGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026602.2-306s1c1
Sequence:CCGGCTCAGCATGAAACGATATGAACTCGAGTTCATATCGTTTCATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026602.2-572s1c1
Sequence:CCGGGCAGCTTACAGCTGGATCTAACTCGAGTTAGATCCAGCTGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026602.3-817s21c1
Sequence:CCGGCCATGGACTATGTAAACTGTTCTCGAGAACAGTTTACATAGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026602.3-229s21c1
Sequence:CCGGCGGATTATTCTGCCTTTGAAACTCGAGTTTCAAAGGCAGAATAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026602.3-306s21c1
Sequence:CCGGCTCAGCATGAAACGATATGAACTCGAGTTCATATCGTTTCATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026602.3-572s21c1
Sequence:CCGGGCAGCTTACAGCTGGATCTAACTCGAGTTAGATCCAGCTGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026602.3-285s21c1
Sequence:CCGGGCTCGACAACCGATTGAATTACTCGAGTAATTCAATCGGTTGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026602
VALIDATED
BCAS2 MISSION shRNA shRNA Plasmid DNA
breast carcinoma amplified sequence 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026602.2-817s1c1
Sequence:CCGGCCATGGACTATGTAAACTGTTCTCGAGAACAGTTTACATAGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026602.2-229s1c1
Sequence:CCGGCGGATTATTCTGCCTTTGAAACTCGAGTTTCAAAGGCAGAATAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026602.2-285s1c1
Sequence:CCGGGCTCGACAACCGATTGAATTACTCGAGTAATTCAATCGGTTGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026602.2-306s1c1
Sequence:CCGGCTCAGCATGAAACGATATGAACTCGAGTTCATATCGTTTCATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026602.2-572s1c1
Sequence:CCGGGCAGCTTACAGCTGGATCTAACTCGAGTTAGATCCAGCTGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026602.3-817s21c1
Sequence:CCGGCCATGGACTATGTAAACTGTTCTCGAGAACAGTTTACATAGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026602.3-229s21c1
Sequence:CCGGCGGATTATTCTGCCTTTGAAACTCGAGTTTCAAAGGCAGAATAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026602.3-306s21c1
Sequence:CCGGCTCAGCATGAAACGATATGAACTCGAGTTCATATCGTTTCATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026602.3-572s21c1
Sequence:CCGGGCAGCTTACAGCTGGATCTAACTCGAGTTAGATCCAGCTGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026602.3-285s21c1
Sequence:CCGGGCTCGACAACCGATTGAATTACTCGAGTAATTCAATCGGTTGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026602
VALIDATED
BCAS2 MISSION shRNA Lentiviral Transduction Particles
breast carcinoma amplified sequence 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026602.2-817s1c1
Sequence:CCGGCCATGGACTATGTAAACTGTTCTCGAGAACAGTTTACATAGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026602.2-229s1c1
Sequence:CCGGCGGATTATTCTGCCTTTGAAACTCGAGTTTCAAAGGCAGAATAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026602.2-285s1c1
Sequence:CCGGGCTCGACAACCGATTGAATTACTCGAGTAATTCAATCGGTTGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026602.2-306s1c1
Sequence:CCGGCTCAGCATGAAACGATATGAACTCGAGTTCATATCGTTTCATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026602.2-572s1c1
Sequence:CCGGGCAGCTTACAGCTGGATCTAACTCGAGTTAGATCCAGCTGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026602.3-817s21c1
Sequence:CCGGCCATGGACTATGTAAACTGTTCTCGAGAACAGTTTACATAGTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026602.3-229s21c1
Sequence:CCGGCGGATTATTCTGCCTTTGAAACTCGAGTTTCAAAGGCAGAATAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026602.3-306s21c1
Sequence:CCGGCTCAGCATGAAACGATATGAACTCGAGTTCATATCGTTTCATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026602.3-572s21c1
Sequence:CCGGGCAGCTTACAGCTGGATCTAACTCGAGTTAGATCCAGCTGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026602.3-285s21c1
Sequence:CCGGGCTCGACAACCGATTGAATTACTCGAGTAATTCAATCGGTTGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005872
VALIDATED
BCAS2 MISSION shRNA Bacterial Glycerol Stock
breast carcinoma amplified sequence 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005872.2-218s1c1
Sequence:CCGGCCCGGATTATTCTGCCTTTGACTCGAGTCAAAGGCAGAATAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005872.2-173s1c1
Sequence:CCGGTCGCAGATACCGACCTACTAACTCGAGTTAGTAGGTCGGTATCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005872.2-454s1c1
Sequence:CCGGCCTGGAAAGTATACAATGAAACTCGAGTTTCATTGTATACTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005872.2-869s1c1
Sequence:CCGGGCTGTGGTAATTCTATTTGTACTCGAGTACAAATAGAATTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005872.2-642s1c1
Sequence:CCGGCGGACTATTGTTCAGCTAGAACTCGAGTTCTAGCTGAACAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-642s21c1
Sequence:CCGGCGGACTATTGTTCAGCTAGAACTCGAGTTCTAGCTGAACAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-454s21c1
Sequence:CCGGCCTGGAAAGTATACAATGAAACTCGAGTTTCATTGTATACTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-218s21c1
Sequence:CCGGCCCGGATTATTCTGCCTTTGACTCGAGTCAAAGGCAGAATAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-869s21c1
Sequence:CCGGGCTGTGGTAATTCTATTTGTACTCGAGTACAAATAGAATTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-173s21c1
Sequence:CCGGTCGCAGATACCGACCTACTAACTCGAGTTAGTAGGTCGGTATCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005872
VALIDATED
BCAS2 MISSION shRNA shRNA Plasmid DNA
breast carcinoma amplified sequence 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005872.2-218s1c1
Sequence:CCGGCCCGGATTATTCTGCCTTTGACTCGAGTCAAAGGCAGAATAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005872.2-173s1c1
Sequence:CCGGTCGCAGATACCGACCTACTAACTCGAGTTAGTAGGTCGGTATCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005872.2-454s1c1
Sequence:CCGGCCTGGAAAGTATACAATGAAACTCGAGTTTCATTGTATACTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005872.2-869s1c1
Sequence:CCGGGCTGTGGTAATTCTATTTGTACTCGAGTACAAATAGAATTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005872.2-642s1c1
Sequence:CCGGCGGACTATTGTTCAGCTAGAACTCGAGTTCTAGCTGAACAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-642s21c1
Sequence:CCGGCGGACTATTGTTCAGCTAGAACTCGAGTTCTAGCTGAACAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-454s21c1
Sequence:CCGGCCTGGAAAGTATACAATGAAACTCGAGTTTCATTGTATACTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-218s21c1
Sequence:CCGGCCCGGATTATTCTGCCTTTGACTCGAGTCAAAGGCAGAATAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-869s21c1
Sequence:CCGGGCTGTGGTAATTCTATTTGTACTCGAGTACAAATAGAATTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-173s21c1
Sequence:CCGGTCGCAGATACCGACCTACTAACTCGAGTTAGTAGGTCGGTATCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005872
VALIDATED
BCAS2 MISSION shRNA Lentiviral Transduction Particles
breast carcinoma amplified sequence 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005872.2-218s1c1
Sequence:CCGGCCCGGATTATTCTGCCTTTGACTCGAGTCAAAGGCAGAATAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005872.2-173s1c1
Sequence:CCGGTCGCAGATACCGACCTACTAACTCGAGTTAGTAGGTCGGTATCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005872.2-454s1c1
Sequence:CCGGCCTGGAAAGTATACAATGAAACTCGAGTTTCATTGTATACTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074948    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005872.2-869s1c1
Sequence:CCGGGCTGTGGTAATTCTATTTGTACTCGAGTACAAATAGAATTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005872.2-642s1c1
Sequence:CCGGCGGACTATTGTTCAGCTAGAACTCGAGTTCTAGCTGAACAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-642s21c1
Sequence:CCGGCGGACTATTGTTCAGCTAGAACTCGAGTTCTAGCTGAACAATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-454s21c1
Sequence:CCGGCCTGGAAAGTATACAATGAAACTCGAGTTTCATTGTATACTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-218s21c1
Sequence:CCGGCCCGGATTATTCTGCCTTTGACTCGAGTCAAAGGCAGAATAATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-869s21c1
Sequence:CCGGGCTGTGGTAATTCTATTTGTACTCGAGTACAAATAGAATTACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005872.2-173s21c1
Sequence:CCGGTCGCAGATACCGACCTACTAACTCGAGTTAGTAGGTCGGTATCTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks