EMAIL THIS PAGE TO A FRIEND

BCAS3

breast carcinoma amplified sequence 3

Synonyms: GAOB1 MAAB
Gene ID:
Mouse(192197) breast carcinoma amplified sequence 3
Rat(363662) breast carcinoma amplified sequence 3
Zebrafish(393594) breast carcinoma amplified sequence 3
chicken(417643) breast carcinoma amplified sequence 3
cow(521416) breast carcinoma amplified sequence 3
Horse(100071315) breast carcinoma amplified sequence 3
domestic cat(101090304) breast carcinoma amplified sequence 3
dog(480587) breast carcinoma amplified sequence 3
naked mole-rat(101697365) breast carcinoma amplified sequence 3
domestic guinea pig(100731104) breast carcinoma amplified sequence 3
sheep(101108670) breast carcinoma amplified sequence 3
Domestic Rabbit(100358815) breast carcinoma amplified sequence 3
206 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017679 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099432 Rosetta Predictions human pricing
NM_017679 Rosetta Predictions human pricing
XM_001081081 Rosetta Predictions rat pricing
XM_343952 Rosetta Predictions rat pricing
NM_138681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320699 predicted 885
2 SASI_Hs02_00320700 predicted 565
3 SASI_Hs02_00320701 predicted 201
4 SASI_Hs02_00320702 predicted 1059
5 SASI_Hs02_00320703 predicted 2197
6 SASI_Hs02_00320704 predicted 644
7 SASI_Hs02_00320705 predicted 609
8 SASI_Hs02_00320706 predicted 1018
9 SASI_Hs02_00320707 predicted 227
10 SASI_Hs02_00320708 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041097 predicted 884
2 SASI_Hs01_00041098 predicted 564
3 SASI_Hs02_00350427 predicted 197
4 SASI_Hs01_00041100 predicted 1059
5 SASI_Hs02_00350428 predicted 2152
6 SASI_Hs01_00041102 predicted 648
7 SASI_Hs01_00041105 predicted 601
8 SASI_Hs01_00041106 predicted 1015
9 SASI_Hs02_00350429 predicted 231
10 SASI_Hs02_00350430 predicted 470
11 SASI_Hs01_00041099 predicted 1820
12 SASI_Hs01_00041101 predicted 406
13 SASI_Hs01_00041103 predicted 1823
14 SASI_Hs01_00041104 predicted 1785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370534 predicted 1093
2 SASI_Rn02_00370535 predicted 913
3 SASI_Rn02_00370536 predicted 1811
4 SASI_Rn02_00370537 predicted 655
5 SASI_Rn02_00370538 predicted 1748
6 SASI_Rn02_00370539 predicted 336
7 SASI_Rn02_00370540 predicted 302
8 SASI_Rn02_00370541 predicted 2021
9 SASI_Rn02_00370542 predicted 1937
10 SASI_Rn02_00370543 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396595 predicted 1086
2 SASI_Rn02_00396596 predicted 920
3 SASI_Rn02_00396597 predicted 1811
4 SASI_Rn02_00396598 predicted 658
5 SASI_Rn02_00396599 predicted 1751
6 SASI_Rn02_00396600 predicted 334
7 SASI_Rn02_00396601 predicted 304
8 SASI_Rn02_00396602 predicted 2018
9 SASI_Rn02_00396603 predicted 1935
10 SASI_Rn02_00396604 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173543 predicted 326
2 SASI_Mm01_00173544 predicted 282
3 SASI_Mm01_00173545 predicted 2375
4 SASI_Mm01_00173546 predicted 1065
5 SASI_Mm02_00339764 predicted 642
6 SASI_Mm02_00339765 predicted 2005
7 SASI_Mm01_00173548 predicted 1612
8 SASI_Mm01_00173549 predicted 1914
9 SASI_Mm01_00173550 predicted 225
10 SASI_Mm01_00173551 predicted 1791
11 SASI_Mm01_00173547 predicted 1784
12 SASI_Mm01_00173552 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138681
VALIDATED
BCAS3 MISSION shRNA Bacterial Glycerol Stock
breast carcinoma amplified sequence 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138681.3-3044s21c1
Sequence:CCGGCCACCTTCCCTAAGCTTAGTGCTCGAGCACTAAGCTTAGGGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138681.3-2455s21c1
Sequence:CCGGACGGATGATCTAGATCTTAACCTCGAGGTTAAGATCTAGATCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138681.3-1686s21c1
Sequence:CCGGAGTGACGCCTCTTGCGCAAATCTCGAGATTTGCGCAAGAGGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138681.3-2006s21c1
Sequence:CCGGTCAGTACTGCTCCCAAGATAACTCGAGTTATCTTGGGAGCAGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138681.3-1451s21c1
Sequence:CCGGTGTCACCACGAGTAGTCAATCCTCGAGGATTGACTACTCGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138681
VALIDATED
BCAS3 MISSION shRNA shRNA Plasmid DNA
breast carcinoma amplified sequence 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138681.3-3044s21c1
Sequence:CCGGCCACCTTCCCTAAGCTTAGTGCTCGAGCACTAAGCTTAGGGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138681.3-2455s21c1
Sequence:CCGGACGGATGATCTAGATCTTAACCTCGAGGTTAAGATCTAGATCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138681.3-1686s21c1
Sequence:CCGGAGTGACGCCTCTTGCGCAAATCTCGAGATTTGCGCAAGAGGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138681.3-2006s21c1
Sequence:CCGGTCAGTACTGCTCCCAAGATAACTCGAGTTATCTTGGGAGCAGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138681.3-1451s21c1
Sequence:CCGGTGTCACCACGAGTAGTCAATCCTCGAGGATTGACTACTCGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138681
VALIDATED
BCAS3 MISSION shRNA Lentiviral Transduction Particles
breast carcinoma amplified sequence 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138681.3-3044s21c1
Sequence:CCGGCCACCTTCCCTAAGCTTAGTGCTCGAGCACTAAGCTTAGGGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138681.3-2455s21c1
Sequence:CCGGACGGATGATCTAGATCTTAACCTCGAGGTTAAGATCTAGATCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138681.3-1686s21c1
Sequence:CCGGAGTGACGCCTCTTGCGCAAATCTCGAGATTTGCGCAAGAGGCGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138681.3-2006s21c1
Sequence:CCGGTCAGTACTGCTCCCAAGATAACTCGAGTTATCTTGGGAGCAGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138681.3-1451s21c1
Sequence:CCGGTGTCACCACGAGTAGTCAATCCTCGAGGATTGACTACTCGTGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017679
BCAS3 MISSION shRNA Bacterial Glycerol Stock
breast carcinoma amplified sequence 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-2267s1c1
Sequence:CCGGCCACAGTTATCTCATCCAGTTCTCGAGAACTGGATGAGATAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-493s1c1
Sequence:CCGGCTTGGTGTTTGTAAGAGCATTCTCGAGAATGCTCTTACAAACACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-2711s1c1
Sequence:CCGGGAAACTTTGATGGCTACCGATCTCGAGATCGGTAGCCATCAAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-1780s1c1
Sequence:CCGGGCAAATAATGCAGGTCTGAAACTCGAGTTTCAGACCTGCATTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017679.2-2270s1c1
Sequence:CCGGCAGTTATCTCATCCAGTTCATCTCGAGATGAACTGGATGAGATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-1703s1c1
Sequence:CCGGCACAAATTTCACCCAGCAAATCTCGAGATTTGCTGGGTGAAATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017679
BCAS3 MISSION shRNA shRNA Plasmid DNA
breast carcinoma amplified sequence 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-2267s1c1
Sequence:CCGGCCACAGTTATCTCATCCAGTTCTCGAGAACTGGATGAGATAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-493s1c1
Sequence:CCGGCTTGGTGTTTGTAAGAGCATTCTCGAGAATGCTCTTACAAACACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-2711s1c1
Sequence:CCGGGAAACTTTGATGGCTACCGATCTCGAGATCGGTAGCCATCAAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-1780s1c1
Sequence:CCGGGCAAATAATGCAGGTCTGAAACTCGAGTTTCAGACCTGCATTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017679.2-2270s1c1
Sequence:CCGGCAGTTATCTCATCCAGTTCATCTCGAGATGAACTGGATGAGATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-1703s1c1
Sequence:CCGGCACAAATTTCACCCAGCAAATCTCGAGATTTGCTGGGTGAAATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017679
BCAS3 MISSION shRNA Lentiviral Transduction Particles
breast carcinoma amplified sequence 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-2267s1c1
Sequence:CCGGCCACAGTTATCTCATCCAGTTCTCGAGAACTGGATGAGATAACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-493s1c1
Sequence:CCGGCTTGGTGTTTGTAAGAGCATTCTCGAGAATGCTCTTACAAACACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-2711s1c1
Sequence:CCGGGAAACTTTGATGGCTACCGATCTCGAGATCGGTAGCCATCAAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-1780s1c1
Sequence:CCGGGCAAATAATGCAGGTCTGAAACTCGAGTTTCAGACCTGCATTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017679.2-2270s1c1
Sequence:CCGGCAGTTATCTCATCCAGTTCATCTCGAGATGAACTGGATGAGATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017679.2-1703s1c1
Sequence:CCGGCACAAATTTCACCCAGCAAATCTCGAGATTTGCTGGGTGAAATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks