EMAIL THIS PAGE TO A FRIEND

BCAS4

breast carcinoma amplified sequence 4

56 Gene Product Result for
Synonyms: CNOL
Gene ID:
sheep(101118977) breast carcinoma amplified sequence 4
domestic guinea pig(100723699) breast carcinoma amplified sequence 4
naked mole-rat(101724488) breast carcinoma amplified sequence 4
domestic cat(101080773) breast carcinoma amplified sequence 4
dog(611448) breast carcinoma amplified sequence 4
cow(617710) breast carcinoma amplified sequence 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198799 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017843 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064251 MISSION® esiRNA esiRNA human BCAS4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010974 Rosetta Predictions human pricing
NM_017843 Rosetta Predictions human pricing
NM_198799 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101006 predicted 455
2 SASI_Hs01_00101007 predicted 303
3 SASI_Hs01_00101008 predicted 311
4 SASI_Hs01_00101009 predicted 389
5 SASI_Hs02_00305948 predicted 304
6 SASI_Hs01_00101010 predicted 352
7 SASI_Hs01_00101011 predicted 553
8 SASI_Hs01_00101014 predicted 544
9 SASI_Hs02_00305949 predicted 308
10 SASI_Hs01_00101015 predicted 453
11 SASI_Hs01_00101012 predicted 534
12 SASI_Hs01_00101013 predicted 166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215267 predicted 687
2 SASI_Hs01_00215268 predicted 304
3 SASI_Hs01_00215269 predicted 306
4 SASI_Hs01_00215270 predicted 384
5 SASI_Hs01_00215271 predicted 410
6 SASI_Hs02_00350734 predicted 306
7 SASI_Hs01_00215272 predicted 353
8 SASI_Hs01_00215273 predicted 789
9 SASI_Hs01_00215275 predicted 771
10 SASI_Hs02_00350735 predicted 315
11 SASI_Hs01_00215274 predicted 763
12 SASI_Hs01_00215276 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071713 predicted 586
2 SASI_Hs01_00071714 predicted 301
3 SASI_Hs02_00372330 predicted 309
4 SASI_Hs01_00071715 predicted 382
5 SASI_Hs01_00071716 predicted 405
6 SASI_Hs01_00071717 predicted 357
7 SASI_Hs01_00071718 predicted 691
8 SASI_Hs01_00071719 predicted 661
9 SASI_Hs01_00071720 predicted 166
10 SASI_Hs01_00071721 predicted 680
11 SASI_Hs01_00071722 predicted 313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198799
BCAS4 MISSION shRNA Bacterial Glycerol Stock
breast carcinoma amplified sequence 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-495s1c1
Sequence:CCGGCTGTATAGGACGGAGGACTATCTCGAGATAGTCCTCCGTCCTATACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-267s1c1
Sequence:CCGGGCCAAACTGACAGAAATGCGTCTCGAGACGCATTTCTGTCAGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-229s1c1
Sequence:CCGGCTTCACAGATCCTGGAGGAAACTCGAGTTTCCTCCAGGATCTGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-261s1c1
Sequence:CCGGCTTAAGGCCAAACTGACAGAACTCGAGTTCTGTCAGTTTGGCCTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-497s1c1
Sequence:CCGGGTATAGGACGGAGGACTATTTCTCGAGAAATAGTCCTCCGTCCTATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-218s1c1
Sequence:CCGGCAGGAGTGATACTTCACAGATCTCGAGATCTGTGAAGTATCACTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-225s1c1
Sequence:CCGGGATACTTCACAGATCCTGGAGCTCGAGCTCCAGGATCTGTGAAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-256s1c1
Sequence:CCGGCAGTCCTTAAGGCCAAACTGACTCGAGTCAGTTTGGCCTTAAGGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198799
BCAS4 MISSION shRNA shRNA Plasmid DNA
breast carcinoma amplified sequence 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-495s1c1
Sequence:CCGGCTGTATAGGACGGAGGACTATCTCGAGATAGTCCTCCGTCCTATACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-267s1c1
Sequence:CCGGGCCAAACTGACAGAAATGCGTCTCGAGACGCATTTCTGTCAGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-229s1c1
Sequence:CCGGCTTCACAGATCCTGGAGGAAACTCGAGTTTCCTCCAGGATCTGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-261s1c1
Sequence:CCGGCTTAAGGCCAAACTGACAGAACTCGAGTTCTGTCAGTTTGGCCTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-497s1c1
Sequence:CCGGGTATAGGACGGAGGACTATTTCTCGAGAAATAGTCCTCCGTCCTATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-218s1c1
Sequence:CCGGCAGGAGTGATACTTCACAGATCTCGAGATCTGTGAAGTATCACTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-225s1c1
Sequence:CCGGGATACTTCACAGATCCTGGAGCTCGAGCTCCAGGATCTGTGAAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-256s1c1
Sequence:CCGGCAGTCCTTAAGGCCAAACTGACTCGAGTCAGTTTGGCCTTAAGGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198799
BCAS4 MISSION shRNA Lentiviral Transduction Particles
breast carcinoma amplified sequence 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-495s1c1
Sequence:CCGGCTGTATAGGACGGAGGACTATCTCGAGATAGTCCTCCGTCCTATACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-267s1c1
Sequence:CCGGGCCAAACTGACAGAAATGCGTCTCGAGACGCATTTCTGTCAGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-229s1c1
Sequence:CCGGCTTCACAGATCCTGGAGGAAACTCGAGTTTCCTCCAGGATCTGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-261s1c1
Sequence:CCGGCTTAAGGCCAAACTGACAGAACTCGAGTTCTGTCAGTTTGGCCTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-497s1c1
Sequence:CCGGGTATAGGACGGAGGACTATTTCTCGAGAAATAGTCCTCCGTCCTATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-218s1c1
Sequence:CCGGCAGGAGTGATACTTCACAGATCTCGAGATCTGTGAAGTATCACTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-225s1c1
Sequence:CCGGGATACTTCACAGATCCTGGAGCTCGAGCTCCAGGATCTGTGAAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198799.1-256s1c1
Sequence:CCGGCAGTCCTTAAGGCCAAACTGACTCGAGTCAGTTTGGCCTTAAGGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017843
BCAS4 MISSION shRNA Bacterial Glycerol Stock
breast carcinoma amplified sequence 4
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000164842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017843.2-268s1c1
Sequence:CCGGCCAAACTGACAGAAATGCGTGCTCGAGCACGCATTTCTGTCAGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017843
BCAS4 MISSION shRNA shRNA Plasmid DNA
breast carcinoma amplified sequence 4
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000164842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017843.2-268s1c1
Sequence:CCGGCCAAACTGACAGAAATGCGTGCTCGAGCACGCATTTCTGTCAGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017843
BCAS4 MISSION shRNA Lentiviral Transduction Particles
breast carcinoma amplified sequence 4
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000164842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017843.2-268s1c1
Sequence:CCGGCCAAACTGACAGAAATGCGTGCTCGAGCACGCATTTCTGTCAGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)