EMAIL THIS PAGE TO A FRIEND

BCAT1

branched chain amino-acid transaminase 1, cytosolic

253 Gene Product Result for
Synonyms: BCATC BCT1 ECA39 MECA39 PNAS121 PP18
Gene ID:
Human(586) Summary: This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
Mouse(12035) branched chain aminotransferase 1, cytosolic
Rat(29592) branched chain amino acid transaminase 1, cytosolic
Zebrafish(337412) branched chain aminotransferase 1, cytosolic
chicken(418193) branched chain amino-acid transaminase 1, cytosolic
Horse(100068713) branched chain amino-acid transaminase 1, cytosolic
cow(505926) branched chain amino-acid transaminase 1, cytosolic
domestic cat(101097404) branched chain amino-acid transaminase 1, cytosolic
dog(486633) branched chain amino-acid transaminase 1, cytosolic
naked mole-rat(101720534) branched chain amino-acid transaminase 1, cytosolic
domestic guinea pig(100722166) branched chain amino-acid transaminase 1, cytosolic
sheep(443485) branched chain amino-acid transaminase 1, cytosolic
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007532 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007532 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007532 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005504 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005504 siRNAs that have been validated in the lab human pricing
NM_017253 Rosetta Predictions rat pricing
NM_001024468 Rosetta Predictions mouse pricing
NM_007532 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005504 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066057 validated 656
1 SASI_Hs01_00066059 validated 1058
1 SASI_Hs01_00066058 validated 615
2 SASI_Hs01_00066060 predicted 1625
3 SASI_Hs01_00066061 predicted 817
4 SASI_Hs01_00066062 predicted 1404
5 SASI_Hs01_00066063 predicted 827
6 SASI_Hs01_00066064 predicted 745
7 SASI_Hs01_00066065 predicted 705
8 SASI_Hs01_00066066 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064872 predicted 1076
2 SASI_Rn01_00064873 predicted 241
3 SASI_Rn01_00064874 predicted 304
4 SASI_Rn01_00064875 predicted 359
5 SASI_Rn01_00064876 predicted 928
6 SASI_Rn01_00064877 predicted 852
7 SASI_Rn01_00064878 predicted 690
8 SASI_Rn01_00064879 predicted 842
9 SASI_Rn01_00064881 predicted 244
10 SASI_Rn02_00261642 predicted 695
11 SASI_Rn01_00064880 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070517 predicted 1145
2 SASI_Mm01_00070518 predicted 1219
3 SASI_Mm01_00070519 predicted 994
4 SASI_Mm01_00070520 predicted 1478
5 SASI_Mm01_00070521 predicted 1079
6 SASI_Mm01_00070522 predicted 913
7 SASI_Mm02_00287585 predicted 1336
8 SASI_Mm02_00287586 predicted 668
9 SASI_Mm02_00287587 predicted 1153
10 SASI_Mm02_00287588 predicted 445
11 SASI_Mm01_00070513 predicted 1247
12 SASI_Mm01_00070514 predicted 650
13 SASI_Mm01_00070515 predicted 486
14 SASI_Mm01_00070516 predicted 1291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050509 predicted 1534
2 SASI_Mm02_00311854 predicted 1611
3 SASI_Mm01_00050510 predicted 1393
4 SASI_Mm01_00050511 predicted 1868
5 SASI_Mm01_00050512 predicted 1467
6 SASI_Mm01_00050513 predicted 1311
7 SASI_Mm01_00050514 predicted 1729
8 SASI_Mm02_00311855 predicted 1056
9 SASI_Mm02_00311856 predicted 1549
10 SASI_Mm02_00311857 predicted 836
11 SASI_Mm01_00050505 predicted 1195
12 SASI_Mm01_00050506 predicted 606
13 SASI_Mm01_00050507 predicted 431
14 SASI_Mm01_00050508 predicted 1241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007532
VALIDATED
BCAT1 MISSION shRNA Bacterial Glycerol Stock
branched chain amino-acid transaminase 1, cytosolic
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-1245s1c1
Sequence:CCGGGCATATTCCAACGATGGAGAACTCGAGTTCTCCATCGTTGGAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-727s1c1
Sequence:CCGGCCTTCCAAAGCCCTACTCTTTCTCGAGAAAGAGTAGGGCTTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-395s1c1
Sequence:CCGGGATGGGAGAAACCTCACATTACTCGAGTAATGTGAGGTTTCTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-533s1c1
Sequence:CCGGCGGACCTCAACATGGATAGAACTCGAGTTCTATCCATGTTGAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-2145s1c1
Sequence:CCGGCCCAGCACATAGTAGGTATTTCTCGAGAAATACCTACTATGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007532.5-2214s21c1
Sequence:CCGGCCCAGCACATAGTAGGTATTTCTCGAGAAATACCTACTATGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007532.5-795s21c1
Sequence:CCGGCCTTCCAAAGCCCTACTCTTTCTCGAGAAAGAGTAGGGCTTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007532.5-1313s21c1
Sequence:CCGGGCATATTCCAACGATGGAGAACTCGAGTTCTCCATCGTTGGAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007532.5-463s21c1
Sequence:CCGGGATGGGAGAAACCTCACATTACTCGAGTAATGTGAGGTTTCTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007532
VALIDATED
BCAT1 MISSION shRNA shRNA Plasmid DNA
branched chain amino-acid transaminase 1, cytosolic
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-1245s1c1
Sequence:CCGGGCATATTCCAACGATGGAGAACTCGAGTTCTCCATCGTTGGAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-727s1c1
Sequence:CCGGCCTTCCAAAGCCCTACTCTTTCTCGAGAAAGAGTAGGGCTTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-395s1c1
Sequence:CCGGGATGGGAGAAACCTCACATTACTCGAGTAATGTGAGGTTTCTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-533s1c1
Sequence:CCGGCGGACCTCAACATGGATAGAACTCGAGTTCTATCCATGTTGAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-2145s1c1
Sequence:CCGGCCCAGCACATAGTAGGTATTTCTCGAGAAATACCTACTATGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007532.5-2214s21c1
Sequence:CCGGCCCAGCACATAGTAGGTATTTCTCGAGAAATACCTACTATGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007532.5-795s21c1
Sequence:CCGGCCTTCCAAAGCCCTACTCTTTCTCGAGAAAGAGTAGGGCTTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007532.5-1313s21c1
Sequence:CCGGGCATATTCCAACGATGGAGAACTCGAGTTCTCCATCGTTGGAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007532.5-463s21c1
Sequence:CCGGGATGGGAGAAACCTCACATTACTCGAGTAATGTGAGGTTTCTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007532
VALIDATED
BCAT1 MISSION shRNA Lentiviral Transduction Particles
branched chain amino-acid transaminase 1, cytosolic
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-1245s1c1
Sequence:CCGGGCATATTCCAACGATGGAGAACTCGAGTTCTCCATCGTTGGAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-727s1c1
Sequence:CCGGCCTTCCAAAGCCCTACTCTTTCTCGAGAAAGAGTAGGGCTTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-395s1c1
Sequence:CCGGGATGGGAGAAACCTCACATTACTCGAGTAATGTGAGGTTTCTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-533s1c1
Sequence:CCGGCGGACCTCAACATGGATAGAACTCGAGTTCTATCCATGTTGAGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007532.2-2145s1c1
Sequence:CCGGCCCAGCACATAGTAGGTATTTCTCGAGAAATACCTACTATGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007532.5-2214s21c1
Sequence:CCGGCCCAGCACATAGTAGGTATTTCTCGAGAAATACCTACTATGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007532.5-795s21c1
Sequence:CCGGCCTTCCAAAGCCCTACTCTTTCTCGAGAAAGAGTAGGGCTTTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007532.5-1313s21c1
Sequence:CCGGGCATATTCCAACGATGGAGAACTCGAGTTCTCCATCGTTGGAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007532.5-463s21c1
Sequence:CCGGGATGGGAGAAACCTCACATTACTCGAGTAATGTGAGGTTTCTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005504
VALIDATED
BCAT1 MISSION shRNA Bacterial Glycerol Stock
branched chain amino-acid transaminase 1, cytosolic
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005906    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005504.3-4040s1c1
Sequence:CCGGCCATTCTTCAAGACTTAGTTACTCGAGTAACTAAGTCTTGAAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005504.3-625s1c1
Sequence:CCGGGCTTTGCACTATGCAGTGGAACTCGAGTTCCACTGCATAGTGCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005504.3-751s1c1
Sequence:CCGGCTGCCGGTATTTGACAAAGAACTCGAGTTCTTTGTCAAATACCGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005504.3-1064s1c1
Sequence:CCGGCCCAATGTGAAGCAGTAGATACTCGAGTATCTACTGCTTCACATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005504.3-1367s1c1
Sequence:CCGGCCTGTGTTGTTTGCCCAGTTTCTCGAGAAACTGGGCAAACAACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005504.5-884s21c1
Sequence:CCGGGATCAAGAATGGGTCCCATATCTCGAGATATGGGACCCATTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005504.5-516s21c1
Sequence:CCGGTTAAGGCTAAAGACCTAATAGCTCGAGCTATTAGGTCTTTAGCCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005504.5-1837s21c1
Sequence:CCGGCATTAATGTAAGCCATATAACCTCGAGGTTATATGGCTTACATTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005504.5-1003s21c1
Sequence:CCGGGAGCCCAGTGGGACCTTATTTCTCGAGAAATAAGGTCCCACTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005504
VALIDATED
BCAT1 MISSION shRNA shRNA Plasmid DNA
branched chain amino-acid transaminase 1, cytosolic
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005906    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005504.3-4040s1c1
Sequence:CCGGCCATTCTTCAAGACTTAGTTACTCGAGTAACTAAGTCTTGAAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005504.3-625s1c1
Sequence:CCGGGCTTTGCACTATGCAGTGGAACTCGAGTTCCACTGCATAGTGCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005504.3-751s1c1
Sequence:CCGGCTGCCGGTATTTGACAAAGAACTCGAGTTCTTTGTCAAATACCGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005504.3-1064s1c1
Sequence:CCGGCCCAATGTGAAGCAGTAGATACTCGAGTATCTACTGCTTCACATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005504.3-1367s1c1
Sequence:CCGGCCTGTGTTGTTTGCCCAGTTTCTCGAGAAACTGGGCAAACAACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005504.5-884s21c1
Sequence:CCGGGATCAAGAATGGGTCCCATATCTCGAGATATGGGACCCATTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005504.5-516s21c1
Sequence:CCGGTTAAGGCTAAAGACCTAATAGCTCGAGCTATTAGGTCTTTAGCCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005504.5-1837s21c1
Sequence:CCGGCATTAATGTAAGCCATATAACCTCGAGGTTATATGGCTTACATTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005504.5-1003s21c1
Sequence:CCGGGAGCCCAGTGGGACCTTATTTCTCGAGAAATAAGGTCCCACTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005504
VALIDATED
BCAT1 MISSION shRNA Lentiviral Transduction Particles
branched chain amino-acid transaminase 1, cytosolic
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005906    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005504.3-4040s1c1
Sequence:CCGGCCATTCTTCAAGACTTAGTTACTCGAGTAACTAAGTCTTGAAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005504.3-625s1c1
Sequence:CCGGGCTTTGCACTATGCAGTGGAACTCGAGTTCCACTGCATAGTGCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005504.3-751s1c1
Sequence:CCGGCTGCCGGTATTTGACAAAGAACTCGAGTTCTTTGTCAAATACCGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005504.3-1064s1c1
Sequence:CCGGCCCAATGTGAAGCAGTAGATACTCGAGTATCTACTGCTTCACATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005504.3-1367s1c1
Sequence:CCGGCCTGTGTTGTTTGCCCAGTTTCTCGAGAAACTGGGCAAACAACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005504.5-884s21c1
Sequence:CCGGGATCAAGAATGGGTCCCATATCTCGAGATATGGGACCCATTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005504.5-516s21c1
Sequence:CCGGTTAAGGCTAAAGACCTAATAGCTCGAGCTATTAGGTCTTTAGCCTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005504.5-1837s21c1
Sequence:CCGGCATTAATGTAAGCCATATAACCTCGAGGTTATATGGCTTACATTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005504.5-1003s21c1
Sequence:CCGGGAGCCCAGTGGGACCTTATTTCTCGAGAAATAAGGTCCCACTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks