EMAIL THIS PAGE TO A FRIEND

BCAT2

branched chain amino-acid transaminase 2, mitochondrial

87 Gene Product Result for
Synonyms: BCAM BCATM BCT2 PP18
UniProtKB ID: O15382, B2RB87, O00269, Q96KG1, Q9BTB6, Q9BUU6
Gene ID:
Human(587) Summary: This gene encodes a branched chain aminotransferase found in mitochondria. The encoded protein forms a dimer that catalyzes the first step in the production of the branched chain amino acids leucine, isoleucine, and valine. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(12036) branched chain aminotransferase 2, mitochondrial
Rat(64203) branched chain amino acid transaminase 2, mitochondrial
sheep(443450) branched chain amino-acid transaminase 2, mitochondrial
domestic guinea pig(100728115) branched chain amino-acid transaminase 2, mitochondrial
naked mole-rat(101716132) branched chain amino-acid transaminase 2, mitochondrial
Zebrafish(436949) branched chain aminotransferase 2, mitochondrial
cow(281643) branched chain amino-acid transaminase 2, mitochondrial
Horse(100051237) branched chain amino-acid transaminase 2, mitochondrial
domestic cat(101085087) branched chain amino-acid transaminase 2, mitochondrial
dog(484394) branched chain amino-acid transaminase 2, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009737 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009737 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009737 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001190 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001190 Rosetta Predictions human pricing
NM_022400 Rosetta Predictions rat pricing
NM_009737 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123179 predicted 1107
2 SASI_Hs01_00123180 predicted 1294
3 SASI_Hs01_00123181 predicted 1131
4 SASI_Hs01_00123182 predicted 974
5 SASI_Hs01_00123183 predicted 528
6 SASI_Hs01_00123185 predicted 891
7 SASI_Hs01_00123186 predicted 1165
8 SASI_Hs01_00123187 predicted 978
9 SASI_Hs02_00331330 predicted 354
10 SASI_Hs01_00123188 predicted 928
11 SASI_Hs01_00123184 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072703 predicted 503
2 SASI_Rn02_00263170 predicted 444
3 SASI_Rn01_00072704 predicted 365
4 SASI_Rn01_00072706 predicted 332
5 SASI_Rn01_00072707 predicted 549
6 SASI_Rn01_00072708 predicted 1102
7 SASI_Rn01_00072710 predicted 1134
8 SASI_Rn01_00072711 predicted 1038
9 SASI_Rn02_00263171 predicted 1128
10 SASI_Rn02_00263172 predicted 610
11 SASI_Rn01_00072705 predicted 1123
12 SASI_Rn01_00072709 predicted 201
13 SASI_Rn01_00072712 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165338 predicted 553
2 SASI_Mm01_00165340 predicted 372
3 SASI_Mm01_00165341 predicted 849
4 SASI_Mm01_00165342 predicted 1140
5 SASI_Mm01_00165343 predicted 938
6 SASI_Mm01_00165344 predicted 1259
7 SASI_Mm01_00165345 predicted 312
8 SASI_Mm01_00165346 predicted 446
9 SASI_Mm01_00165347 predicted 1264
10 SASI_Mm02_00316903 predicted 808
11 SASI_Mm01_00165339 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009737
VALIDATED
BCAT2 MISSION shRNA Bacterial Glycerol Stock
branched chain amino-acid transaminase 2, mitochondrial
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009737.2-895s21c1
Sequence:CCGGGCCTGGAGTAGTTCGACAAAGCTCGAGCTTTGTCGAACTACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009737.2-964s21c1
Sequence:CCGGCAAGGTCACTATGAAGGAATTCTCGAGAATTCCTTCATAGTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009737.2-1267s21c1
Sequence:CCGGGAGACTCAAGAGAAGTGCAATCTCGAGATTGCACTTCTCTTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009737.2-1087s21c1
Sequence:CCGGCCACATACCTACCATGGAGAACTCGAGTTCTCCATGGTAGGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009737.1-1268s1c1
Sequence:CCGGGAGACTCAAGAGAAGTGCAATCTCGAGATTGCACTTCTCTTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009737.1-69s1c1
Sequence:CCGGTGGCTTCTATGTGGGTCCAAACTCGAGTTTGGACCCACATAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009737.1-261s1c1
Sequence:CCGGCCCTTCCAGAACCTCACGCTACTCGAGTAGCGTGAGGTTCTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009737.1-1088s1c1
Sequence:CCGGCCACATACCTACCATGGAGAACTCGAGTTCTCCATGGTAGGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009737.1-965s1c1
Sequence:CCGGCAAGGTCACTATGAAGGAATTCTCGAGAATTCCTTCATAGTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009737
VALIDATED
BCAT2 MISSION shRNA shRNA Plasmid DNA
branched chain amino-acid transaminase 2, mitochondrial
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009737.2-895s21c1
Sequence:CCGGGCCTGGAGTAGTTCGACAAAGCTCGAGCTTTGTCGAACTACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009737.2-964s21c1
Sequence:CCGGCAAGGTCACTATGAAGGAATTCTCGAGAATTCCTTCATAGTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009737.2-1267s21c1
Sequence:CCGGGAGACTCAAGAGAAGTGCAATCTCGAGATTGCACTTCTCTTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009737.2-1087s21c1
Sequence:CCGGCCACATACCTACCATGGAGAACTCGAGTTCTCCATGGTAGGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009737.1-1268s1c1
Sequence:CCGGGAGACTCAAGAGAAGTGCAATCTCGAGATTGCACTTCTCTTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009737.1-69s1c1
Sequence:CCGGTGGCTTCTATGTGGGTCCAAACTCGAGTTTGGACCCACATAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009737.1-261s1c1
Sequence:CCGGCCCTTCCAGAACCTCACGCTACTCGAGTAGCGTGAGGTTCTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009737.1-1088s1c1
Sequence:CCGGCCACATACCTACCATGGAGAACTCGAGTTCTCCATGGTAGGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009737.1-965s1c1
Sequence:CCGGCAAGGTCACTATGAAGGAATTCTCGAGAATTCCTTCATAGTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009737
VALIDATED
BCAT2 MISSION shRNA Lentiviral Transduction Particles
branched chain amino-acid transaminase 2, mitochondrial
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009737.2-895s21c1
Sequence:CCGGGCCTGGAGTAGTTCGACAAAGCTCGAGCTTTGTCGAACTACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009737.2-964s21c1
Sequence:CCGGCAAGGTCACTATGAAGGAATTCTCGAGAATTCCTTCATAGTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009737.2-1267s21c1
Sequence:CCGGGAGACTCAAGAGAAGTGCAATCTCGAGATTGCACTTCTCTTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009737.2-1087s21c1
Sequence:CCGGCCACATACCTACCATGGAGAACTCGAGTTCTCCATGGTAGGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009737.1-1268s1c1
Sequence:CCGGGAGACTCAAGAGAAGTGCAATCTCGAGATTGCACTTCTCTTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009737.1-69s1c1
Sequence:CCGGTGGCTTCTATGTGGGTCCAAACTCGAGTTTGGACCCACATAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009737.1-261s1c1
Sequence:CCGGCCCTTCCAGAACCTCACGCTACTCGAGTAGCGTGAGGTTCTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009737.1-1088s1c1
Sequence:CCGGCCACATACCTACCATGGAGAACTCGAGTTCTCCATGGTAGGTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009737.1-965s1c1
Sequence:CCGGCAAGGTCACTATGAAGGAATTCTCGAGAATTCCTTCATAGTGACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001190
VALIDATED
BCAT2 MISSION shRNA Bacterial Glycerol Stock
branched chain amino-acid transaminase 2, mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-1296s21c1
Sequence:CCGGTGAAGTGCAATACGAAATAAACTCGAGTTTATTTCGTATTGCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-717s21c1
Sequence:CCGGACTACAAGTTAGGTGGGAATTCTCGAGAATTCCCACCTAACTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-1076s21c1
Sequence:CCGGGTGCACCGAATCCTGTACAAACTCGAGTTTGTACAGGATTCGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-211s21c1
Sequence:CCGGGAAGACATTTACCGACCACATCTCGAGATGTGGTCGGTAAATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-830s21c1
Sequence:CCGGGTGGGAACCATGAACATCTTTCTCGAGAAAGATGTTCATGGTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-1039s1c1
Sequence:CCGGGTGCACCGAATCCTGTACAAACTCGAGTTTGTACAGGATTCGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-162s1c1
Sequence:CCGGCCTGGTGTTTGGGAAGACATTCTCGAGAATGTCTTCCCAAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-793s1c1
Sequence:CCGGGTGGGAACCATGAACATCTTTCTCGAGAAAGATGTTCATGGTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-174s1c1
Sequence:CCGGGAAGACATTTACCGACCACATCTCGAGATGTGGTCGGTAAATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-680s1c1
Sequence:CCGGACTACAAGTTAGGTGGGAATTCTCGAGAATTCCCACCTAACTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001190
VALIDATED
BCAT2 MISSION shRNA shRNA Plasmid DNA
branched chain amino-acid transaminase 2, mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-1296s21c1
Sequence:CCGGTGAAGTGCAATACGAAATAAACTCGAGTTTATTTCGTATTGCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-717s21c1
Sequence:CCGGACTACAAGTTAGGTGGGAATTCTCGAGAATTCCCACCTAACTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-1076s21c1
Sequence:CCGGGTGCACCGAATCCTGTACAAACTCGAGTTTGTACAGGATTCGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-211s21c1
Sequence:CCGGGAAGACATTTACCGACCACATCTCGAGATGTGGTCGGTAAATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-830s21c1
Sequence:CCGGGTGGGAACCATGAACATCTTTCTCGAGAAAGATGTTCATGGTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-1039s1c1
Sequence:CCGGGTGCACCGAATCCTGTACAAACTCGAGTTTGTACAGGATTCGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-162s1c1
Sequence:CCGGCCTGGTGTTTGGGAAGACATTCTCGAGAATGTCTTCCCAAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-793s1c1
Sequence:CCGGGTGGGAACCATGAACATCTTTCTCGAGAAAGATGTTCATGGTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-174s1c1
Sequence:CCGGGAAGACATTTACCGACCACATCTCGAGATGTGGTCGGTAAATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-680s1c1
Sequence:CCGGACTACAAGTTAGGTGGGAATTCTCGAGAATTCCCACCTAACTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001190
VALIDATED
BCAT2 MISSION shRNA Lentiviral Transduction Particles
branched chain amino-acid transaminase 2, mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-1296s21c1
Sequence:CCGGTGAAGTGCAATACGAAATAAACTCGAGTTTATTTCGTATTGCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-717s21c1
Sequence:CCGGACTACAAGTTAGGTGGGAATTCTCGAGAATTCCCACCTAACTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-1076s21c1
Sequence:CCGGGTGCACCGAATCCTGTACAAACTCGAGTTTGTACAGGATTCGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-211s21c1
Sequence:CCGGGAAGACATTTACCGACCACATCTCGAGATGTGGTCGGTAAATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001190.2-830s21c1
Sequence:CCGGGTGGGAACCATGAACATCTTTCTCGAGAAAGATGTTCATGGTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-1039s1c1
Sequence:CCGGGTGCACCGAATCCTGTACAAACTCGAGTTTGTACAGGATTCGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-162s1c1
Sequence:CCGGCCTGGTGTTTGGGAAGACATTCTCGAGAATGTCTTCCCAAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-793s1c1
Sequence:CCGGGTGGGAACCATGAACATCTTTCTCGAGAAAGATGTTCATGGTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-174s1c1
Sequence:CCGGGAAGACATTTACCGACCACATCTCGAGATGTGGTCGGTAAATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001190.1-680s1c1
Sequence:CCGGACTACAAGTTAGGTGGGAATTCTCGAGAATTCCCACCTAACTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks