EMAIL THIS PAGE TO A FRIEND

BCCIP

BRCA2 and CDKN1A interacting protein

116 Gene Product Result for
Synonyms: TOK-1 TOK1
UniProtKB ID: Q9P287, B3KP45, Q8ND15, Q96GC4, Q9P288
Gene ID:
Human(56647) Summary: This gene product was isolated on the basis of its interaction with BRCA2 and p21 proteins. It is an evolutionarily conserved nuclear protein with multiple interacting domains. The N-terminal half shares moderate homology with regions of calmodulin and M-calpain, suggesting that it may also bind calcium. Functional studies indicate that this protein may be an important cofactor for BRCA2 in tumor suppression, and a modulator of CDK2 kinase activity via p21. This protein has also been implicated in the regulation of BRCA2 and RAD51 nuclear focus formation, double-strand break-induced homologous recombination, and cell cycle progression. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(66165) BRCA2 and CDKN1A interacting protein
Rat(361666) BRCA2 and CDKN1A interacting protein
Zebrafish(541348) BRCA2 and CDKN1A interacting protein
domestic cat(101100756) BRCA2 and CDKN1A interacting protein
cow(512466) BRCA2 and CDKN1A interacting protein
dog(477864) BRCA2 and CDKN1A interacting protein
chicken(426225) BRCA2 and CDKN1A interacting protein
naked mole-rat(101721059) BRCA2 and CDKN1A interacting protein
domestic guinea pig(100733090) BRCA2 and CDKN1A interacting protein
sheep(101116189) BRCA2 and CDKN1A interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_078469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_078469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_078469 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016567 Rosetta Predictions human pricing
NM_078468 Rosetta Predictions human pricing
NM_078469 Rosetta Predictions human pricing
NM_001108505 Rosetta Predictions rat pricing
NM_025392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181301 predicted 210
2 SASI_Hs01_00181302 predicted 323
3 SASI_Hs01_00181303 predicted 281
4 SASI_Hs01_00181304 predicted 340
5 SASI_Hs01_00181305 predicted 322
6 SASI_Hs01_00181306 predicted 221
7 SASI_Hs01_00181307 predicted 288
8 SASI_Hs01_00181308 predicted 462
9 SASI_Hs01_00181309 predicted 434
10 SASI_Hs01_00181310 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202446 predicted 207
2 SASI_Hs01_00202447 predicted 320
3 SASI_Hs01_00202448 predicted 279
4 SASI_Hs01_00202449 predicted 343
5 SASI_Hs01_00202450 predicted 318
6 SASI_Hs01_00202451 predicted 226
7 SASI_Hs01_00202452 predicted 287
8 SASI_Hs01_00202453 predicted 464
9 SASI_Hs01_00202454 predicted 433
10 SASI_Hs01_00202455 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056843 predicted 212
2 SASI_Hs01_00056844 predicted 319
3 SASI_Hs01_00056845 predicted 277
4 SASI_Hs01_00056846 predicted 335
5 SASI_Hs01_00056847 predicted 316
6 SASI_Hs01_00056848 predicted 227
7 SASI_Hs01_00056849 predicted 289
8 SASI_Hs01_00056850 predicted 459
9 SASI_Hs01_00056851 predicted 440
10 SASI_Hs01_00056852 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239309 predicted 478
2 SASI_Rn02_00239310 predicted 181
3 SASI_Rn02_00239311 predicted 213
4 SASI_Rn02_00239312 predicted 399
5 SASI_Rn02_00239313 predicted 276
6 SASI_Rn02_00239314 predicted 213
7 SASI_Rn02_00239315 predicted 221
8 SASI_Rn02_00239316 predicted 402
9 SASI_Rn02_00239317 predicted 247
10 SASI_Rn02_00239318 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328130 predicted 1003
2 SASI_Mm02_00328131 predicted 468
3 SASI_Mm01_00201390 predicted 560
4 SASI_Mm02_00328132 predicted 488
5 SASI_Mm02_00328133 predicted 452
6 SASI_Mm01_00201395 predicted 801
7 SASI_Mm02_00328134 predicted 1013
8 SASI_Mm02_00328135 predicted 651
9 SASI_Mm02_00328136 predicted 558
10 SASI_Mm02_00328137 predicted 649
11 SASI_Mm01_00201387 predicted 990
12 SASI_Mm01_00201388 predicted 992
13 SASI_Mm01_00201389 predicted 547
14 SASI_Mm01_00201391 predicted 897
15 SASI_Mm01_00201392 predicted 859
16 SASI_Mm01_00201393 predicted 1024
17 SASI_Mm01_00201394 predicted 497
18 SASI_Mm01_00201396 predicted 984
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025392
VALIDATED
BCCIP MISSION shRNA Bacterial Glycerol Stock
BRCA2 and CDKN1A interacting protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-230s1c1
Sequence:CCGGGATAACGATTATGGCGGAATTCTCGAGAATTCCGCCATAATCGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-922s1c1
Sequence:CCGGCGGCAGGATGAATGAGATCATCTCGAGATGATCTCATTCATCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-779s1c1
Sequence:CCGGGCAGAGGAAGAGTTCTTCTATCTCGAGATAGAAGAACTCTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-1025s1c1
Sequence:CCGGCCCATTGAAGAGATACTGAAACTCGAGTTTCAGTATCTCTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-863s1c1
Sequence:CCGGAGATGGTCCTTCGATGATGTTCTCGAGAACATCATCGAAGGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025392
VALIDATED
BCCIP MISSION shRNA shRNA Plasmid DNA
BRCA2 and CDKN1A interacting protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-230s1c1
Sequence:CCGGGATAACGATTATGGCGGAATTCTCGAGAATTCCGCCATAATCGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-922s1c1
Sequence:CCGGCGGCAGGATGAATGAGATCATCTCGAGATGATCTCATTCATCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-779s1c1
Sequence:CCGGGCAGAGGAAGAGTTCTTCTATCTCGAGATAGAAGAACTCTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-1025s1c1
Sequence:CCGGCCCATTGAAGAGATACTGAAACTCGAGTTTCAGTATCTCTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-863s1c1
Sequence:CCGGAGATGGTCCTTCGATGATGTTCTCGAGAACATCATCGAAGGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025392
VALIDATED
BCCIP MISSION shRNA Lentiviral Transduction Particles
BRCA2 and CDKN1A interacting protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-230s1c1
Sequence:CCGGGATAACGATTATGGCGGAATTCTCGAGAATTCCGCCATAATCGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-922s1c1
Sequence:CCGGCGGCAGGATGAATGAGATCATCTCGAGATGATCTCATTCATCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-779s1c1
Sequence:CCGGGCAGAGGAAGAGTTCTTCTATCTCGAGATAGAAGAACTCTTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-1025s1c1
Sequence:CCGGCCCATTGAAGAGATACTGAAACTCGAGTTTCAGTATCTCTTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025392.1-863s1c1
Sequence:CCGGAGATGGTCCTTCGATGATGTTCTCGAGAACATCATCGAAGGACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_078469
VALIDATED
BCCIP MISSION shRNA Bacterial Glycerol Stock
BRCA2 and CDKN1A interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_078469.1-906s1c1
Sequence:CCGGGCCAGGATGAATGAAGCCAATCTCGAGATTGGCTTCATTCATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_078469.1-841s1c1
Sequence:CCGGCCAGTTCCGATACAGCACAATCTCGAGATTGTGCTGTATCGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_078469.1-669s1c1
Sequence:CCGGCCTTCTGATTAGTAAGACATTCTCGAGAATGTCTTACTAATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_078469.1-542s1c1
Sequence:CCGGGCCTTCTCCTAAGTGAAAGATCTCGAGATCTTTCACTTAGGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_078469.1-543s1c1
Sequence:CCGGCCTTCTCCTAAGTGAAAGATTCTCGAGAATCTTTCACTTAGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_078469.2-998s21c1
Sequence:CCGGTCTTCATCTGCACTGATTATTCTCGAGAATAATCAGTGCAGATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_078469.2-310s21c1
Sequence:CCGGTAATTCAACAGAACCATATTGCTCGAGCAATATGGTTCTGTTGAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_078469.2-852s21c1
Sequence:CCGGCCAGTTCCGATACAGCACAATCTCGAGATTGTGCTGTATCGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078469.2-553s21c1
Sequence:CCGGGCCTTCTCCTAAGTGAAAGATCTCGAGATCTTTCACTTAGGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078469.2-680s21c1
Sequence:CCGGCCTTCTGATTAGTAAGACATTCTCGAGAATGTCTTACTAATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_078469
VALIDATED
BCCIP MISSION shRNA shRNA Plasmid DNA
BRCA2 and CDKN1A interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_078469.1-906s1c1
Sequence:CCGGGCCAGGATGAATGAAGCCAATCTCGAGATTGGCTTCATTCATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_078469.1-841s1c1
Sequence:CCGGCCAGTTCCGATACAGCACAATCTCGAGATTGTGCTGTATCGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_078469.1-669s1c1
Sequence:CCGGCCTTCTGATTAGTAAGACATTCTCGAGAATGTCTTACTAATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_078469.1-542s1c1
Sequence:CCGGGCCTTCTCCTAAGTGAAAGATCTCGAGATCTTTCACTTAGGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_078469.1-543s1c1
Sequence:CCGGCCTTCTCCTAAGTGAAAGATTCTCGAGAATCTTTCACTTAGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_078469.2-998s21c1
Sequence:CCGGTCTTCATCTGCACTGATTATTCTCGAGAATAATCAGTGCAGATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_078469.2-310s21c1
Sequence:CCGGTAATTCAACAGAACCATATTGCTCGAGCAATATGGTTCTGTTGAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_078469.2-852s21c1
Sequence:CCGGCCAGTTCCGATACAGCACAATCTCGAGATTGTGCTGTATCGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078469.2-553s21c1
Sequence:CCGGGCCTTCTCCTAAGTGAAAGATCTCGAGATCTTTCACTTAGGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078469.2-680s21c1
Sequence:CCGGCCTTCTGATTAGTAAGACATTCTCGAGAATGTCTTACTAATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_078469
VALIDATED
BCCIP MISSION shRNA Lentiviral Transduction Particles
BRCA2 and CDKN1A interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_078469.1-906s1c1
Sequence:CCGGGCCAGGATGAATGAAGCCAATCTCGAGATTGGCTTCATTCATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_078469.1-841s1c1
Sequence:CCGGCCAGTTCCGATACAGCACAATCTCGAGATTGTGCTGTATCGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_078469.1-669s1c1
Sequence:CCGGCCTTCTGATTAGTAAGACATTCTCGAGAATGTCTTACTAATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_078469.1-542s1c1
Sequence:CCGGGCCTTCTCCTAAGTGAAAGATCTCGAGATCTTTCACTTAGGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_078469.1-543s1c1
Sequence:CCGGCCTTCTCCTAAGTGAAAGATTCTCGAGAATCTTTCACTTAGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_078469.2-998s21c1
Sequence:CCGGTCTTCATCTGCACTGATTATTCTCGAGAATAATCAGTGCAGATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_078469.2-310s21c1
Sequence:CCGGTAATTCAACAGAACCATATTGCTCGAGCAATATGGTTCTGTTGAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_078469.2-852s21c1
Sequence:CCGGCCAGTTCCGATACAGCACAATCTCGAGATTGTGCTGTATCGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078469.2-553s21c1
Sequence:CCGGGCCTTCTCCTAAGTGAAAGATCTCGAGATCTTTCACTTAGGAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_078469.2-680s21c1
Sequence:CCGGCCTTCTGATTAGTAAGACATTCTCGAGAATGTCTTACTAATCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks