EMAIL THIS PAGE TO A FRIEND

BCHE

butyrylcholinesterase

148 Gene Product Result for
Synonyms: CHE1 CHE2 E1
UniProtKB ID: P06276, A8K7P8
Gene ID:
Human(590) Summary: Mutant alleles at the BCHE locus are responsible for suxamethonium sensitivity. Homozygous persons sustain prolonged apnea after administration of the muscle relaxant suxamethonium in connection with surgical anesthesia. The activity of pseudocholinesterase in the serum is low and its substrate behavior is atypical. In the absence of the relaxant, the homozygote is at no known disadvantage. [provided by RefSeq, Jul 2008]
Mouse(12038) butyrylcholinesterase
Rat(65036) butyrylcholinesterase
chicken(395358) butyrylcholinesterase
cow(534616) butyrylcholinesterase
Horse(100033901) butyrylcholinesterase
domestic cat(493960) butyrylcholinesterase
dog(488143) butyrylcholinesterase
naked mole-rat(101712877) butyrylcholinesterase
domestic guinea pig(100729351) butyrylcholinesterase
sheep(101102112) butyrylcholinesterase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108580 Anti-BCHE IgG fraction of antiserum mouse, bovine, rabbit, sheep, horse, rat, human, guinea pig, mouse, pig
immunohistochemistry, western blot pricing
HPA001560 Anti-BCHE antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV44208 Anti-BCHE antibody produced in rabbit IgG fraction of antiserum canine, rat, rabbit, horse, sheep, human, rabbit, guinea pig, bovine, mouse, pig
immunohistochemistry, western blot pricing
SAB2701967 Anti-BCHE antibody produced in rabbit human
immunohistochemistry, western blot pricing
SAB4100285 Monoclonal Anti-BCHE antibody produced in mouse clone BCHE-A222, culture supernatant human
western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M100 (−)-N-Methylphysostigmine analytical standard, for drug analysis human pricing
C101400 1,2-Cyclohexanedione 97% human pricing
29059 1,3-Cyclohexanedione purum, for fluorescence, ≥97.0% (T) human pricing
C101605 1,3-Cyclohexanedione 97% human pricing
D33454 1,3-Diphenyl-1,3-propanedione 98% human pricing
223034 1-Phenyl-1,2-propanedione 99% human pricing
W322601 1-Phenyl-1,2-propanedione 98%, FG human pricing
630012 2,2′-Dichlorobenzil 97% human pricing
P57409 2,2′-Pyridil 97% human pricing
454389 2,2′-Thenil 98% human pricing
196118 2,2-Dimethoxy-2-phenylacetophenone 99% human pricing
11038 2,3-Butanedione analytical standard human pricing
B85307 2,3-Butanedione 97% human pricing
W254304 2,3-Heptanedione ≥97%, FG human pricing
241962 2,3-Pentanedione 97% human pricing
W284106 2,3-Pentanedione ≥96%, FCC, FG human pricing
W284114 2,3-Pentanedione natural, ≥96%, FG human pricing
542229 2-Chloro-3′,4′-dimethoxybenzil 97% human pricing
M37935 2-Methyl-1,3-cyclohexanedione 97% human pricing
117021 2-Methyl-1,3-cyclopentanedione 99% human pricing
381802 3,3′-Dimethoxybenzil 99% human pricing
T6601 3,4,5,6-Tetrachloro-1,2-benzoquinone 97% human pricing
157457 3,5-Di-tert-butyl-o-benzoquinone 98% human pricing
W330507 3-Methyl-1,2-cyclohexanedione ≥98%, FG human pricing
328057 4,4′-Dibromobenzil 90%, technical grade human pricing
381322 4,4′-Difluorobenzil 98% human pricing
159611 4,4′-Dimethoxybenzil 98% human pricing
A88409 4,4′-Dimethoxybenzoin 95% human pricing
146706 4,4′-Dimethylbenzil 97% human pricing
12927 4-Benzoylbenzoic acid purum, ≥98.0% (T) human pricing
B12407 4-Benzoylbenzoic acid 99% human pricing
05581 Acetylacetone analytical standard human pricing
P7754 Acetylacetone ReagentPlus®, ≥99% human pricing
10916 Acetylacetone produced by Wacker Chemie AG, Burghausen, Germany, ≥99.5% (GC) human pricing
B5151 Benzil 98% human pricing
399396 Benzoin purified by sublimation, ≥99.5% human pricing
W213209 Benzoin ≥98% human pricing
B8681 Benzoin 98% human pricing
343528 Benzyl sulfone 99% human pricing
45374 Chloranil PESTANAL®, analytical standard human pricing
PS11 Chloranil analytical standard human pricing
138029 Furil 98% human pricing
192651 Furoin 98% human pricing
556114 N-(4-Carboxyphenyl)succinamic acid 96% human pricing
12309 p-Benzoquinone for spectrophotometric det. of amines, ≥99.5% (HPLC) human pricing
B10358 p-Benzoquinone reagent grade, ≥98% Green Alternative human pricing
232017 Tetrachloro-1,4-benzoquinone 99% human pricing
T1505 Tetraisopropyl pyrophosphoramide butyrylcholinesterase inhibitor human pricing
E8375 Eserine human, mouse, rat pricing
45710 Eserine ≥98.0% (N) human, mouse, rat pricing
T5625 (±)-α-Lipoic acid synthetic, ≥99% (titration), powder human, rat pricing
T1395 (±)-α-Lipoic acid BioReagent, cell culture tested, ≥99% human, rat pricing
62320 (±)-α-Lipoic acid ≥98.0% human, rat pricing
H5777 (±)-Huperzine A synthetic, ≥98% (TLC) human, rat pricing
H5902 (−)-Huperzine A human, rat pricing
D133 6,7-Dichloroquinoxaline-2,3-dione human, rat pricing
277738 Benzophenone-(carbonyl-13C) 99 atom % 13C human, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0478 AQUA Peptide IFFPGVSEFG[K] human pricing
AQ0479 AQUA Peptide YLTLNTEST[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000055 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009738 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009738 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009738 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000055 Rosetta Predictions human pricing
NM_022942 Rosetta Predictions rat pricing
NM_009738 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154211 predicted 1886
2 SASI_Hs01_00154212 predicted 309
3 SASI_Hs01_00154214 predicted 1759
4 SASI_Hs01_00154215 predicted 649
5 SASI_Hs02_00301765 predicted 527
6 SASI_Hs02_00301766 predicted 629
7 SASI_Hs01_00154216 predicted 1952
8 SASI_Hs01_00154217 predicted 245
9 SASI_Hs01_00154218 predicted 1282
10 SASI_Hs01_00154220 predicted 970
11 SASI_Hs01_00154213 predicted 1984
12 SASI_Hs01_00154219 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108366 predicted 1192
2 SASI_Rn01_00108367 predicted 336
3 SASI_Rn01_00108368 predicted 1440
4 SASI_Rn01_00108369 predicted 419
5 SASI_Rn01_00108370 predicted 1459
6 SASI_Rn02_00263666 predicted 466
7 SASI_Rn01_00108371 predicted 871
8 SASI_Rn02_00263667 predicted 863
9 SASI_Rn01_00108372 predicted 315
10 SASI_Rn02_00263668 predicted 482
11 SASI_Rn01_00108373 predicted 328
12 SASI_Rn01_00108374 predicted 1328
13 SASI_Rn01_00108375 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025668 predicted 635
2 SASI_Mm01_00025669 predicted 2098
3 SASI_Mm01_00025671 predicted 787
4 SASI_Mm01_00025673 predicted 1149
5 SASI_Mm02_00316904 predicted 709
6 SASI_Mm01_00025674 predicted 374
7 SASI_Mm01_00025675 predicted 1318
8 SASI_Mm02_00316905 predicted 293
9 SASI_Mm01_00025676 predicted 1631
10 SASI_Mm02_00316906 predicted 557
11 SASI_Mm01_00025670 predicted 1761
12 SASI_Mm01_00025672 predicted 1923
13 SASI_Mm01_00025677 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000055
VALIDATED
BCHE MISSION shRNA Bacterial Glycerol Stock
butyrylcholinesterase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000055.1-1148s1c1
Sequence:CCGGCCAGACATATTACTTGAACTTCTCGAGAAGTTCAAGTAATATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000055.1-641s1c1
Sequence:CCGGGCTCGGGTTGAAAGAGTTATTCTCGAGAATAACTCTTTCAACCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000055.1-1586s1c1
Sequence:CCGGCCTCTGGAAAGAAGAGATAATCTCGAGATTATCTCTTCTTTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000055.1-728s1c1
Sequence:CCGGCCAGGGAACATGGGTTTATTTCTCGAGAAATAAACCCATGTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000055.1-1746s1c1
Sequence:CCGGCCTTGAATACAGAGTCAACAACTCGAGTTGTTGACTCTGTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000055.2-969s21c1
Sequence:CCGGGAACGTTGAACTTAGCTAAATCTCGAGATTTAGCTAAGTTCAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000055.2-439s21c1
Sequence:CCGGCTGTCAGAACATAGATCAAAGCTCGAGCTTTGATCTATGTTCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000055.2-1117s21c1
Sequence:CCGGTCCGACCGTGGATGGTGATTTCTCGAGAAATCACCATCCACGGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000055
VALIDATED
BCHE MISSION shRNA shRNA Plasmid DNA
butyrylcholinesterase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000055.1-1148s1c1
Sequence:CCGGCCAGACATATTACTTGAACTTCTCGAGAAGTTCAAGTAATATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000055.1-641s1c1
Sequence:CCGGGCTCGGGTTGAAAGAGTTATTCTCGAGAATAACTCTTTCAACCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000055.1-1586s1c1
Sequence:CCGGCCTCTGGAAAGAAGAGATAATCTCGAGATTATCTCTTCTTTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000055.1-728s1c1
Sequence:CCGGCCAGGGAACATGGGTTTATTTCTCGAGAAATAAACCCATGTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000055.1-1746s1c1
Sequence:CCGGCCTTGAATACAGAGTCAACAACTCGAGTTGTTGACTCTGTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000055.2-969s21c1
Sequence:CCGGGAACGTTGAACTTAGCTAAATCTCGAGATTTAGCTAAGTTCAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000055.2-439s21c1
Sequence:CCGGCTGTCAGAACATAGATCAAAGCTCGAGCTTTGATCTATGTTCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000055.2-1117s21c1
Sequence:CCGGTCCGACCGTGGATGGTGATTTCTCGAGAAATCACCATCCACGGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000055
VALIDATED
BCHE MISSION shRNA Lentiviral Transduction Particles
butyrylcholinesterase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000055.1-1148s1c1
Sequence:CCGGCCAGACATATTACTTGAACTTCTCGAGAAGTTCAAGTAATATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000055.1-641s1c1
Sequence:CCGGGCTCGGGTTGAAAGAGTTATTCTCGAGAATAACTCTTTCAACCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000055.1-1586s1c1
Sequence:CCGGCCTCTGGAAAGAAGAGATAATCTCGAGATTATCTCTTCTTTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000055.1-728s1c1
Sequence:CCGGCCAGGGAACATGGGTTTATTTCTCGAGAAATAAACCCATGTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000055.1-1746s1c1
Sequence:CCGGCCTTGAATACAGAGTCAACAACTCGAGTTGTTGACTCTGTATTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000055.2-969s21c1
Sequence:CCGGGAACGTTGAACTTAGCTAAATCTCGAGATTTAGCTAAGTTCAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000055.2-439s21c1
Sequence:CCGGCTGTCAGAACATAGATCAAAGCTCGAGCTTTGATCTATGTTCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000055.2-1117s21c1
Sequence:CCGGTCCGACCGTGGATGGTGATTTCTCGAGAAATCACCATCCACGGTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009738
VALIDATED
BCHE MISSION shRNA Bacterial Glycerol Stock
butyrylcholinesterase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-1047s1c1
Sequence:CCGGGCTCAGATCTTAGTGGGAGTTCTCGAGAACTCCCACTAAGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-588s1c1
Sequence:CCGGGCTCCAGGAAACATGGGTTTACTCGAGTAAACCCATGTTTCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-454s1c1
Sequence:CCGGGCTTTCAAACTGGGACCTCTTCTCGAGAAGAGGTCCCAGTTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-504s1c1
Sequence:CCGGGCTCGTGTTGAAAGAGTTATTCTCGAGAATAACTCTTTCAACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-909s1c1
Sequence:CCGGCCTCAGGAAATTCTTCGCAATCTCGAGATTGCGAAGAATTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009738.3-1319s21c1
Sequence:CCGGGCTCAGATCTTAGTGGGAGTTCTCGAGAACTCCCACTAAGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009738.3-1181s21c1
Sequence:CCGGCCTCAGGAAATTCTTCGCAATCTCGAGATTGCGAAGAATTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009738.3-860s21c1
Sequence:CCGGGCTCCAGGAAACATGGGTTTACTCGAGTAAACCCATGTTTCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009738.3-776s21c1
Sequence:CCGGGCTCGTGTTGAAAGAGTTATTCTCGAGAATAACTCTTTCAACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009738.3-2159s21c1
Sequence:CCGGCAGTAGCTCTCTCCATATATACTCGAGTATATATGGAGAGAGCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009738
VALIDATED
BCHE MISSION shRNA shRNA Plasmid DNA
butyrylcholinesterase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-1047s1c1
Sequence:CCGGGCTCAGATCTTAGTGGGAGTTCTCGAGAACTCCCACTAAGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-588s1c1
Sequence:CCGGGCTCCAGGAAACATGGGTTTACTCGAGTAAACCCATGTTTCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-454s1c1
Sequence:CCGGGCTTTCAAACTGGGACCTCTTCTCGAGAAGAGGTCCCAGTTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-504s1c1
Sequence:CCGGGCTCGTGTTGAAAGAGTTATTCTCGAGAATAACTCTTTCAACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-909s1c1
Sequence:CCGGCCTCAGGAAATTCTTCGCAATCTCGAGATTGCGAAGAATTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009738.3-1319s21c1
Sequence:CCGGGCTCAGATCTTAGTGGGAGTTCTCGAGAACTCCCACTAAGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009738.3-1181s21c1
Sequence:CCGGCCTCAGGAAATTCTTCGCAATCTCGAGATTGCGAAGAATTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009738.3-860s21c1
Sequence:CCGGGCTCCAGGAAACATGGGTTTACTCGAGTAAACCCATGTTTCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009738.3-776s21c1
Sequence:CCGGGCTCGTGTTGAAAGAGTTATTCTCGAGAATAACTCTTTCAACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009738.3-2159s21c1
Sequence:CCGGCAGTAGCTCTCTCCATATATACTCGAGTATATATGGAGAGAGCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009738
VALIDATED
BCHE MISSION shRNA Lentiviral Transduction Particles
butyrylcholinesterase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-1047s1c1
Sequence:CCGGGCTCAGATCTTAGTGGGAGTTCTCGAGAACTCCCACTAAGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-588s1c1
Sequence:CCGGGCTCCAGGAAACATGGGTTTACTCGAGTAAACCCATGTTTCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-454s1c1
Sequence:CCGGGCTTTCAAACTGGGACCTCTTCTCGAGAAGAGGTCCCAGTTTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-504s1c1
Sequence:CCGGGCTCGTGTTGAAAGAGTTATTCTCGAGAATAACTCTTTCAACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009738.1-909s1c1
Sequence:CCGGCCTCAGGAAATTCTTCGCAATCTCGAGATTGCGAAGAATTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009738.3-1319s21c1
Sequence:CCGGGCTCAGATCTTAGTGGGAGTTCTCGAGAACTCCCACTAAGATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009738.3-1181s21c1
Sequence:CCGGCCTCAGGAAATTCTTCGCAATCTCGAGATTGCGAAGAATTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009738.3-860s21c1
Sequence:CCGGGCTCCAGGAAACATGGGTTTACTCGAGTAAACCCATGTTTCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009738.3-776s21c1
Sequence:CCGGGCTCGTGTTGAAAGAGTTATTCTCGAGAATAACTCTTTCAACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009738.3-2159s21c1
Sequence:CCGGCAGTAGCTCTCTCCATATATACTCGAGTATATATGGAGAGAGCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks