EMAIL THIS PAGE TO A FRIEND

BCKDHA

branched chain keto acid dehydrogenase E1, alpha polypeptide

68 Gene Product Result for
Synonyms: BCKDE1A MSU MSUD1 OVD1A
UniProtKB ID: P12694, Q16034, Q16472
Gene ID:
Human(593) Summary: The branched-chain alpha-keto acid (BCAA) dehydrogenase (BCKD) complex is an innter mitochondrial enzyme complex that catalyzes the second major step in the catabolism of the branched-chain amino acids leucine, isoleucine, and valine. The BCKD complex consists of three catalytic components: a heterotetrameric (alpha2-beta2) branched-chain alpha-keto acid decarboxylase (E1), a dihydrolipoyl transacylase (E2), and a dihydrolipoamide dehydrogenase (E3). This gene encodes the alpha subunit of the decarboxylase (E1) component. Mutations in this gene result in maple syrup urine disease, type IA. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(12039) branched chain ketoacid dehydrogenase E1, alpha polypeptide
Rat(25244) branched chain ketoacid dehydrogenase E1, alpha polypeptide
Zebrafish(554124) branched chain keto acid dehydrogenase E1, alpha polypeptide
chicken(374210) branched chain keto acid dehydrogenase E1, alpha polypeptide
dog(484488) branched chain keto acid dehydrogenase E1, alpha polypeptide
Horse(100068678) branched chain keto acid dehydrogenase E1, alpha polypeptide
cow(282149) branched chain keto acid dehydrogenase E1, alpha polypeptide
domestic cat(101087186) branched chain keto acid dehydrogenase E1, alpha polypeptide
sheep(100145857) branched chain keto acid dehydrogenase E1, alpha polypeptide
Domestic Rabbit(100352048) branched chain keto acid dehydrogenase E1, alpha polypeptide
domestic guinea pig(100715185) branched chain keto acid dehydrogenase E1, alpha polypeptide
naked mole-rat(101705928) branched chain keto acid dehydrogenase E1, alpha polypeptide
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405509 Anti-BCKDHA antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA036640 Anti-BCKDHA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2702057 Anti-BCKDHA antibody produced in rabbit human
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB2104058 Anti-BCKDHA, (N-terminal) antibody produced in rabbit affinity isolated antibody pig, human, horse, bovine, canine, guinea pig, sheep, mouse, zebrafish, rat, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000709 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007533 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007533 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007533 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000709 Rosetta Predictions human pricing
NM_012782 Rosetta Predictions rat pricing
XM_001070046 Rosetta Predictions rat pricing
NM_007533 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161345 predicted 821
2 SASI_Hs02_00303112 predicted 207
3 SASI_Hs01_00161354 predicted 1016
4 SASI_Hs02_00303113 predicted 807
5 SASI_Hs02_00303114 predicted 820
6 SASI_Hs02_00303115 predicted 234
7 SASI_Hs01_00161346 predicted 201
8 SASI_Hs02_00303116 predicted 1346
9 SASI_Hs02_00303117 predicted 890
10 SASI_Hs01_00161347 predicted 1430
11 SASI_Hs01_00161348 predicted 932
12 SASI_Hs01_00161349 predicted 898
13 SASI_Hs01_00161350 predicted 1346
14 SASI_Hs01_00161351 predicted 1252
15 SASI_Hs01_00161352 predicted 860
16 SASI_Hs01_00161353 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064149 predicted 339
2 SASI_Rn01_00064150 predicted 688
3 SASI_Rn01_00064152 predicted 894
4 SASI_Rn01_00064153 predicted 976
5 SASI_Rn01_00064154 predicted 525
6 SASI_Rn01_00064155 predicted 386
7 SASI_Rn01_00064156 predicted 884
8 SASI_Rn01_00064157 predicted 983
9 SASI_Rn01_00064158 predicted 636
10 SASI_Rn02_00260186 predicted 462
11 SASI_Rn01_00064151 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330234 predicted 436
2 SASI_Rn02_00330235 predicted 792
3 SASI_Rn02_00330236 predicted 999
4 SASI_Rn02_00330237 predicted 1076
5 SASI_Rn02_00330238 predicted 625
6 SASI_Rn02_00330239 predicted 487
7 SASI_Rn02_00330240 predicted 986
8 SASI_Rn02_00330241 predicted 1089
9 SASI_Rn02_00330242 predicted 736
10 SASI_Rn02_00330243 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196539 predicted 1441
2 SASI_Mm01_00196540 predicted 468
3 SASI_Mm01_00196542 predicted 1116
4 SASI_Mm02_00311858 predicted 552
5 SASI_Mm01_00196543 predicted 621
6 SASI_Mm01_00196544 predicted 1052
7 SASI_Mm01_00196546 predicted 340
8 SASI_Mm01_00196547 predicted 1099
9 SASI_Mm01_00196548 predicted 405
10 SASI_Mm02_00311859 predicted 996
11 SASI_Mm01_00196541 predicted 566
12 SASI_Mm01_00196545 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000709
VALIDATED
BCKDHA MISSION shRNA Bacterial Glycerol Stock
branched chain keto acid dehydrogenase E1, alpha polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000709.2-1343s21c1
Sequence:CCGGCCCACTGGATCACTTCGATAACTCGAGTTATCGAAGTGATCCAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000709.2-1247s21c1
Sequence:CCGGCCTACTCTTCTCAGACGTGTACTCGAGTACACGTCTGAGAAGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000709.2-335s21c1
Sequence:CCGGGCTGAAGCTCTACAAGAGCATCTCGAGATGCTCTTGTAGAGCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000709.2-921s21c1
Sequence:CCGGGTGGATGGTAATGATGTGTTTCTCGAGAAACACATCATTACCATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000709.2-921s1c1
Sequence:CCGGGTGGATGGTAATGATGTGTTTCTCGAGAAACACATCATTACCATCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000709.2-1077s1c1
Sequence:CCGGGAGGTCAATTACTGGGATAAACTCGAGTTTATCCCAGTAATTGACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000709.2-1343s1c1
Sequence:CCGGCCCACTGGATCACTTCGATAACTCGAGTTATCGAAGTGATCCAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000709.2-1247s1c1
Sequence:CCGGCCTACTCTTCTCAGACGTGTACTCGAGTACACGTCTGAGAAGAGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000709.2-335s1c1
Sequence:CCGGGCTGAAGCTCTACAAGAGCATCTCGAGATGCTCTTGTAGAGCTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000709
VALIDATED
BCKDHA MISSION shRNA shRNA Plasmid DNA
branched chain keto acid dehydrogenase E1, alpha polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000709.2-1343s21c1
Sequence:CCGGCCCACTGGATCACTTCGATAACTCGAGTTATCGAAGTGATCCAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000709.2-1247s21c1
Sequence:CCGGCCTACTCTTCTCAGACGTGTACTCGAGTACACGTCTGAGAAGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000709.2-335s21c1
Sequence:CCGGGCTGAAGCTCTACAAGAGCATCTCGAGATGCTCTTGTAGAGCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000709.2-921s21c1
Sequence:CCGGGTGGATGGTAATGATGTGTTTCTCGAGAAACACATCATTACCATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000709.2-921s1c1
Sequence:CCGGGTGGATGGTAATGATGTGTTTCTCGAGAAACACATCATTACCATCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000709.2-1077s1c1
Sequence:CCGGGAGGTCAATTACTGGGATAAACTCGAGTTTATCCCAGTAATTGACCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000709.2-1343s1c1
Sequence:CCGGCCCACTGGATCACTTCGATAACTCGAGTTATCGAAGTGATCCAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000709.2-1247s1c1
Sequence:CCGGCCTACTCTTCTCAGACGTGTACTCGAGTACACGTCTGAGAAGAGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000709.2-335s1c1
Sequence:CCGGGCTGAAGCTCTACAAGAGCATCTCGAGATGCTCTTGTAGAGCTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000709
VALIDATED
BCKDHA MISSION shRNA Lentiviral Transduction Particles
branched chain keto acid dehydrogenase E1, alpha polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000709.2-1343s21c1
Sequence:CCGGCCCACTGGATCACTTCGATAACTCGAGTTATCGAAGTGATCCAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000709.2-1247s21c1
Sequence:CCGGCCTACTCTTCTCAGACGTGTACTCGAGTACACGTCTGAGAAGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000709.2-335s21c1
Sequence:CCGGGCTGAAGCTCTACAAGAGCATCTCGAGATGCTCTTGTAGAGCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000709.2-921s21c1
Sequence:CCGGGTGGATGGTAATGATGTGTTTCTCGAGAAACACATCATTACCATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000709.2-921s1c1
Sequence:CCGGGTGGATGGTAATGATGTGTTTCTCGAGAAACACATCATTACCATCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000709.2-1077s1c1
Sequence:CCGGGAGGTCAATTACTGGGATAAACTCGAGTTTATCCCAGTAATTGACCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000709.2-1343s1c1
Sequence:CCGGCCCACTGGATCACTTCGATAACTCGAGTTATCGAAGTGATCCAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000709.2-1247s1c1
Sequence:CCGGCCTACTCTTCTCAGACGTGTACTCGAGTACACGTCTGAGAAGAGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000709.2-335s1c1
Sequence:CCGGGCTGAAGCTCTACAAGAGCATCTCGAGATGCTCTTGTAGAGCTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007533
VALIDATED
BCKDHA MISSION shRNA Bacterial Glycerol Stock
branched chain keto acid dehydrogenase E1, alpha polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-409s21c1
Sequence:CCGGTCCTTCTACATGACCAACTATCTCGAGATAGTTGGTCATGTAGAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-1176s21c1
Sequence:CCGGGCAGTCACGAAAGAAGGTCATCTCGAGATGACCTTCTTTCGTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-711s21c1
Sequence:CCGGCCGGATTGTGATCTGTTACTTCTCGAGAAGTAACAGATCACAATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-1071s21c1
Sequence:CCGGCGAGGTCAATTACTGGGACAACTCGAGTTGTCCCAGTAATTGACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-216s21c1
Sequence:CCGGGCTTGAGTTCATCCAGCCCAACTCGAGTTGGGCTGGATGAACTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-421s1c1
Sequence:CCGGTCCTTCTACATGACCAACTATCTCGAGATAGTTGGTCATGTAGAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-228s1c1
Sequence:CCGGGCTTGAGTTCATCCAGCCCAACTCGAGTTGGGCTGGATGAACTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-1083s1c1
Sequence:CCGGCGAGGTCAATTACTGGGACAACTCGAGTTGTCCCAGTAATTGACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-723s1c1
Sequence:CCGGCCGGATTGTGATCTGTTACTTCTCGAGAAGTAACAGATCACAATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-1188s1c1
Sequence:CCGGGCAGTCACGAAAGAAGGTCATCTCGAGATGACCTTCTTTCGTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007533
VALIDATED
BCKDHA MISSION shRNA shRNA Plasmid DNA
branched chain keto acid dehydrogenase E1, alpha polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-409s21c1
Sequence:CCGGTCCTTCTACATGACCAACTATCTCGAGATAGTTGGTCATGTAGAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-1176s21c1
Sequence:CCGGGCAGTCACGAAAGAAGGTCATCTCGAGATGACCTTCTTTCGTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-711s21c1
Sequence:CCGGCCGGATTGTGATCTGTTACTTCTCGAGAAGTAACAGATCACAATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-1071s21c1
Sequence:CCGGCGAGGTCAATTACTGGGACAACTCGAGTTGTCCCAGTAATTGACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-216s21c1
Sequence:CCGGGCTTGAGTTCATCCAGCCCAACTCGAGTTGGGCTGGATGAACTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-421s1c1
Sequence:CCGGTCCTTCTACATGACCAACTATCTCGAGATAGTTGGTCATGTAGAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-228s1c1
Sequence:CCGGGCTTGAGTTCATCCAGCCCAACTCGAGTTGGGCTGGATGAACTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-1083s1c1
Sequence:CCGGCGAGGTCAATTACTGGGACAACTCGAGTTGTCCCAGTAATTGACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-723s1c1
Sequence:CCGGCCGGATTGTGATCTGTTACTTCTCGAGAAGTAACAGATCACAATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-1188s1c1
Sequence:CCGGGCAGTCACGAAAGAAGGTCATCTCGAGATGACCTTCTTTCGTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007533
VALIDATED
BCKDHA MISSION shRNA Lentiviral Transduction Particles
branched chain keto acid dehydrogenase E1, alpha polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-409s21c1
Sequence:CCGGTCCTTCTACATGACCAACTATCTCGAGATAGTTGGTCATGTAGAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-1176s21c1
Sequence:CCGGGCAGTCACGAAAGAAGGTCATCTCGAGATGACCTTCTTTCGTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-711s21c1
Sequence:CCGGCCGGATTGTGATCTGTTACTTCTCGAGAAGTAACAGATCACAATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-1071s21c1
Sequence:CCGGCGAGGTCAATTACTGGGACAACTCGAGTTGTCCCAGTAATTGACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007533.5-216s21c1
Sequence:CCGGGCTTGAGTTCATCCAGCCCAACTCGAGTTGGGCTGGATGAACTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-421s1c1
Sequence:CCGGTCCTTCTACATGACCAACTATCTCGAGATAGTTGGTCATGTAGAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-228s1c1
Sequence:CCGGGCTTGAGTTCATCCAGCCCAACTCGAGTTGGGCTGGATGAACTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-1083s1c1
Sequence:CCGGCGAGGTCAATTACTGGGACAACTCGAGTTGTCCCAGTAATTGACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-723s1c1
Sequence:CCGGCCGGATTGTGATCTGTTACTTCTCGAGAAGTAACAGATCACAATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007533.2-1188s1c1
Sequence:CCGGGCAGTCACGAAAGAAGGTCATCTCGAGATGACCTTCTTTCGTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)