EMAIL THIS PAGE TO A FRIEND

BCKDHB

branched chain keto acid dehydrogenase E1, beta polypeptide

63 Gene Product Result for
Synonyms: E1B dJ279A18.1
UniProtKB ID: P21953, Q9BQL0
Gene ID:
Human(594) Summary: Branched-chain keto acid dehydrogenase is a multienzyme complex associated with the inner membrane of mitochondria, and functions in the catabolism of branched-chain amino acids. The complex consists of multiple copies of 3 components: branched-chain alpha-keto acid decarboxylase (E1), lipoamide acyltransferase (E2) and lipoamide dehydrogenase (E3). This gene encodes the E1 beta subunit, and mutations therein have been associated with maple syrup urine disease (MSUD), type 1B, a disease characterized by a maple syrup odor to the urine in addition to mental and physical retardation, and feeding problems. Alternative splicing at this locus results in transcript variants with different 3' non-coding regions, but encoding the same isoform. [provided by RefSeq, Jul 2008]
Mouse(12040) branched chain ketoacid dehydrogenase E1, beta polypeptide
Rat(29711) branched chain keto acid dehydrogenase E1, beta polypeptide
naked mole-rat(101725476) branched chain keto acid dehydrogenase E1, beta polypeptide
domestic guinea pig(100731951) branched chain keto acid dehydrogenase E1, beta polypeptide
sheep(101113939) branched chain keto acid dehydrogenase E1, beta polypeptide
Domestic Rabbit(100353682) branched chain keto acid dehydrogenase E1, beta polypeptide
Zebrafish(569980) branched chain ketoacid dehydrogenase E1, beta polypeptide
cow(282150) branched chain keto acid dehydrogenase E1, beta polypeptide
Horse(100065300) branched chain keto acid dehydrogenase E1, beta polypeptide
domestic cat(101080635) branched chain keto acid dehydrogenase E1, beta polypeptide
dog(474978) branched chain keto acid dehydrogenase E1, beta polypeptide
chicken(395375) branched chain keto acid dehydrogenase E1, beta polypeptide
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_183050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183050 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000056 Rosetta Predictions human pricing
NM_183050 Rosetta Predictions human pricing
NM_019267 Rosetta Predictions rat pricing
NM_199195 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131197 predicted 476
2 SASI_Hs01_00131199 predicted 317
3 SASI_Hs01_00131200 predicted 248
4 SASI_Hs01_00131201 predicted 802
5 SASI_Hs01_00131202 predicted 322
6 SASI_Hs01_00131203 predicted 680
7 SASI_Hs02_00301767 predicted 385
8 SASI_Hs01_00131205 predicted 965
9 SASI_Hs02_00301768 predicted 817
10 SASI_Hs01_00131206 predicted 996
11 SASI_Hs01_00131198 predicted 796
12 SASI_Hs01_00131204 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182292 predicted 485
2 SASI_Hs01_00182294 predicted 320
3 SASI_Hs01_00182295 predicted 249
4 SASI_Hs01_00182296 predicted 806
5 SASI_Hs01_00182297 predicted 327
6 SASI_Hs01_00182298 predicted 679
7 SASI_Hs02_00371214 predicted 388
8 SASI_Hs01_00182300 predicted 963
9 SASI_Hs02_00371215 predicted 816
10 SASI_Hs01_00182301 predicted 991
11 SASI_Hs01_00182293 predicted 800
12 SASI_Hs01_00182299 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262161 predicted 1215
2 SASI_Rn02_00262162 predicted 496
3 SASI_Rn02_00262163 predicted 346
4 SASI_Rn02_00262164 predicted 453
5 SASI_Rn02_00262165 predicted 1150
6 SASI_Rn02_00262166 predicted 381
7 SASI_Rn02_00262167 predicted 211
8 SASI_Rn02_00262168 predicted 456
9 SASI_Rn02_00262169 predicted 403
10 SASI_Rn02_00262170 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110777 predicted 314
2 SASI_Mm02_00351379 predicted 400
3 SASI_Mm01_00110778 predicted 412
4 SASI_Mm01_00110779 predicted 877
5 SASI_Mm01_00110780 predicted 817
6 SASI_Mm01_00110782 predicted 1066
7 SASI_Mm01_00110783 predicted 1128
8 SASI_Mm01_00110784 predicted 600
9 SASI_Mm01_00110785 predicted 826
10 SASI_Mm01_00110786 predicted 368
11 SASI_Mm01_00110781 predicted 1039
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199195
VALIDATED
BCKDHB MISSION shRNA Bacterial Glycerol Stock
branched chain keto acid dehydrogenase E1, beta polypeptide
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199195.1-1219s1c1
Sequence:CCGGGCAACGAACTGTCATGGATATCTCGAGATATCCATGACAGTTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199195.1-1041s1c1
Sequence:CCGGCCTCACATCTTTGAGCCCTTTCTCGAGAAAGGGCTCAAAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199195.1-974s1c1
Sequence:CCGGCCAGGAAGAATGTTTCTTGAACTCGAGTTCAAGAAACATTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199195.1-561s1c1
Sequence:CCGGCCAGGGATCAAGGTGGTAATACTCGAGTATTACCACCTTGATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199195.1-179s1c1
Sequence:CCGGCCTGGATAACTCATTAGCCAACTCGAGTTGGCTAATGAGTTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-1141s21c1
Sequence:CCGGCATGACCAGACATGGAAATATCTCGAGATATTTCCATGTCTGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199195.1-352s21c1
Sequence:CCGGTCACCGGTGCTACAGCTATTGCTCGAGCAATAGCTGTAGCACCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-378s21c1
Sequence:CCGGATCCAGTTTGCCGACTATATTCTCGAGAATATAGTCGGCAAACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-840s21c1
Sequence:CCGGGTCATCGATCTGCGGACAATTCTCGAGAATTGTCCGCAGATCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-1096s21c1
Sequence:CCGGTTCGCAAGATGATCAACTATTCTCGAGAATAGTTGATCATCTTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-421s21c1
Sequence:CCGGTCAACGAAGCTGCCAAGTATCCTCGAGGATACTTGGCAGCTTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-249s21c1
Sequence:CCGGTTCCGATGCACTGTTGGTTTACTCGAGTAAACCAACAGTGCATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199195
VALIDATED
BCKDHB MISSION shRNA shRNA Plasmid DNA
branched chain keto acid dehydrogenase E1, beta polypeptide
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199195.1-1219s1c1
Sequence:CCGGGCAACGAACTGTCATGGATATCTCGAGATATCCATGACAGTTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199195.1-1041s1c1
Sequence:CCGGCCTCACATCTTTGAGCCCTTTCTCGAGAAAGGGCTCAAAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199195.1-974s1c1
Sequence:CCGGCCAGGAAGAATGTTTCTTGAACTCGAGTTCAAGAAACATTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199195.1-561s1c1
Sequence:CCGGCCAGGGATCAAGGTGGTAATACTCGAGTATTACCACCTTGATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199195.1-179s1c1
Sequence:CCGGCCTGGATAACTCATTAGCCAACTCGAGTTGGCTAATGAGTTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-1141s21c1
Sequence:CCGGCATGACCAGACATGGAAATATCTCGAGATATTTCCATGTCTGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199195.1-352s21c1
Sequence:CCGGTCACCGGTGCTACAGCTATTGCTCGAGCAATAGCTGTAGCACCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-378s21c1
Sequence:CCGGATCCAGTTTGCCGACTATATTCTCGAGAATATAGTCGGCAAACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-840s21c1
Sequence:CCGGGTCATCGATCTGCGGACAATTCTCGAGAATTGTCCGCAGATCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-1096s21c1
Sequence:CCGGTTCGCAAGATGATCAACTATTCTCGAGAATAGTTGATCATCTTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-421s21c1
Sequence:CCGGTCAACGAAGCTGCCAAGTATCCTCGAGGATACTTGGCAGCTTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-249s21c1
Sequence:CCGGTTCCGATGCACTGTTGGTTTACTCGAGTAAACCAACAGTGCATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199195
VALIDATED
BCKDHB MISSION shRNA Lentiviral Transduction Particles
branched chain keto acid dehydrogenase E1, beta polypeptide
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199195.1-1219s1c1
Sequence:CCGGGCAACGAACTGTCATGGATATCTCGAGATATCCATGACAGTTCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199195.1-1041s1c1
Sequence:CCGGCCTCACATCTTTGAGCCCTTTCTCGAGAAAGGGCTCAAAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199195.1-974s1c1
Sequence:CCGGCCAGGAAGAATGTTTCTTGAACTCGAGTTCAAGAAACATTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199195.1-561s1c1
Sequence:CCGGCCAGGGATCAAGGTGGTAATACTCGAGTATTACCACCTTGATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199195.1-179s1c1
Sequence:CCGGCCTGGATAACTCATTAGCCAACTCGAGTTGGCTAATGAGTTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-1141s21c1
Sequence:CCGGCATGACCAGACATGGAAATATCTCGAGATATTTCCATGTCTGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199195.1-352s21c1
Sequence:CCGGTCACCGGTGCTACAGCTATTGCTCGAGCAATAGCTGTAGCACCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-378s21c1
Sequence:CCGGATCCAGTTTGCCGACTATATTCTCGAGAATATAGTCGGCAAACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-840s21c1
Sequence:CCGGGTCATCGATCTGCGGACAATTCTCGAGAATTGTCCGCAGATCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-1096s21c1
Sequence:CCGGTTCGCAAGATGATCAACTATTCTCGAGAATAGTTGATCATCTTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-421s21c1
Sequence:CCGGTCAACGAAGCTGCCAAGTATCCTCGAGGATACTTGGCAGCTTCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199195.1-249s21c1
Sequence:CCGGTTCCGATGCACTGTTGGTTTACTCGAGTAAACCAACAGTGCATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183050
VALIDATED
BCKDHB MISSION shRNA Bacterial Glycerol Stock
branched chain keto acid dehydrogenase E1, beta polypeptide
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-1086s1c1
Sequence:CCGGGAGGAATGTTTCTTGAACCTACTCGAGTAGGTTCAAGAAACATTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-972s1c1
Sequence:CCGGCCTTGGGATGTGGACACAATTCTCGAGAATTGTGTCCACATCCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-1164s1c1
Sequence:CCGGCCATTCTACATCCCAGACAAACTCGAGTTTGTCTGGGATGTAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-481s1c1
Sequence:CCGGCGGAAATTCAGTTTGCAGATTCTCGAGAATCTGCAAACTGAATTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-269s1c1
Sequence:CCGGCCAGTCTGTAACAAGTGCCTTCTCGAGAAGGCACTTGTTACAGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183050.2-488s21c1
Sequence:CCGGGCTACTGCCATTGCGGAAATTCTCGAGAATTTCCGCAATGGCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183050.2-1120s21c1
Sequence:CCGGGAACCTAGAGGCTCCTATATCCTCGAGGATATAGGAGCCTCTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183050.2-3041s21c1
Sequence:CCGGTACCGGTGTAGATGCTATATTCTCGAGAATATAGCATCTACACCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183050.2-970s21c1
Sequence:CCGGCATTGATCTGAGGACTATAATCTCGAGATTATAGTCCTCAGATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183050.2-1233s21c1
Sequence:CCGGTGATCAACTATTGACCATATACTCGAGTATATGGTCAATAGTTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183050
VALIDATED
BCKDHB MISSION shRNA shRNA Plasmid DNA
branched chain keto acid dehydrogenase E1, beta polypeptide
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-1086s1c1
Sequence:CCGGGAGGAATGTTTCTTGAACCTACTCGAGTAGGTTCAAGAAACATTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-972s1c1
Sequence:CCGGCCTTGGGATGTGGACACAATTCTCGAGAATTGTGTCCACATCCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-1164s1c1
Sequence:CCGGCCATTCTACATCCCAGACAAACTCGAGTTTGTCTGGGATGTAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-481s1c1
Sequence:CCGGCGGAAATTCAGTTTGCAGATTCTCGAGAATCTGCAAACTGAATTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-269s1c1
Sequence:CCGGCCAGTCTGTAACAAGTGCCTTCTCGAGAAGGCACTTGTTACAGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183050.2-488s21c1
Sequence:CCGGGCTACTGCCATTGCGGAAATTCTCGAGAATTTCCGCAATGGCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183050.2-1120s21c1
Sequence:CCGGGAACCTAGAGGCTCCTATATCCTCGAGGATATAGGAGCCTCTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183050.2-3041s21c1
Sequence:CCGGTACCGGTGTAGATGCTATATTCTCGAGAATATAGCATCTACACCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183050.2-970s21c1
Sequence:CCGGCATTGATCTGAGGACTATAATCTCGAGATTATAGTCCTCAGATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183050.2-1233s21c1
Sequence:CCGGTGATCAACTATTGACCATATACTCGAGTATATGGTCAATAGTTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183050
VALIDATED
BCKDHB MISSION shRNA Lentiviral Transduction Particles
branched chain keto acid dehydrogenase E1, beta polypeptide
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-1086s1c1
Sequence:CCGGGAGGAATGTTTCTTGAACCTACTCGAGTAGGTTCAAGAAACATTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-972s1c1
Sequence:CCGGCCTTGGGATGTGGACACAATTCTCGAGAATTGTGTCCACATCCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-1164s1c1
Sequence:CCGGCCATTCTACATCCCAGACAAACTCGAGTTTGTCTGGGATGTAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-481s1c1
Sequence:CCGGCGGAAATTCAGTTTGCAGATTCTCGAGAATCTGCAAACTGAATTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_183050.1-269s1c1
Sequence:CCGGCCAGTCTGTAACAAGTGCCTTCTCGAGAAGGCACTTGTTACAGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183050.2-488s21c1
Sequence:CCGGGCTACTGCCATTGCGGAAATTCTCGAGAATTTCCGCAATGGCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183050.2-1120s21c1
Sequence:CCGGGAACCTAGAGGCTCCTATATCCTCGAGGATATAGGAGCCTCTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183050.2-3041s21c1
Sequence:CCGGTACCGGTGTAGATGCTATATTCTCGAGAATATAGCATCTACACCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183050.2-970s21c1
Sequence:CCGGCATTGATCTGAGGACTATAATCTCGAGATTATAGTCCTCAGATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183050.2-1233s21c1
Sequence:CCGGTGATCAACTATTGACCATATACTCGAGTATATGGTCAATAGTTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks