EMAIL THIS PAGE TO A FRIEND

BCKDK

branched chain ketoacid dehydrogenase kinase

148 Gene Product Result for
Synonyms: BCKDKD BDK
UniProtKB ID: O14874, Q6FGL4, Q96IN5
Gene ID:
Human(10295) Summary: The branched-chain alpha-ketoacid dehydrogenase complex (BCKD) is an important regulator of the valine, leucine, and isoleucine catabolic pathways. The protein encoded by this gene is found in the mitochondrion, where it phosphorylates and inactivates BCKD. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(12041) branched chain ketoacid dehydrogenase kinase
Rat(29603) branched chain ketoacid dehydrogenase kinase
Zebrafish(282677) branched chain alpha-ketoacid dehydrogenase kinase
cow(505005) branched chain ketoacid dehydrogenase kinase
domestic cat(101089414) branched chain ketoacid dehydrogenase kinase
dog(479776) branched chain ketoacid dehydrogenase kinase
sheep(101104290) branched chain ketoacid dehydrogenase kinase
domestic guinea pig(100717874) branched chain ketoacid dehydrogenase kinase
naked mole-rat(101715390) branched chain ketoacid dehydrogenase kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005881 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005881 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005881 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122957 Rosetta Predictions human pricing
NM_005881 Rosetta Predictions human pricing
NM_019244 Rosetta Predictions rat pricing
XM_579427 Rosetta Predictions rat pricing
NM_009739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327587 predicted 585
2 SASI_Hs02_00327588 predicted 1158
3 SASI_Hs02_00327589 predicted 888
4 SASI_Hs02_00327590 predicted 1166
5 SASI_Hs02_00327591 predicted 600
6 SASI_Hs02_00327592 predicted 517
7 SASI_Hs02_00327593 predicted 988
8 SASI_Hs02_00327594 predicted 920
9 SASI_Hs02_00327595 predicted 534
10 SASI_Hs02_00327596 predicted 1759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340471 predicted 581
2 SASI_Hs01_00224815 predicted 1163
3 SASI_Hs01_00224816 predicted 893
4 SASI_Hs01_00224817 predicted 1172
5 SASI_Hs02_00340472 predicted 593
6 SASI_Hs01_00224819 predicted 516
7 SASI_Hs01_00224822 predicted 986
8 SASI_Hs01_00224824 predicted 929
9 SASI_Hs02_00340473 predicted 532
10 SASI_Hs02_00340474 predicted 1669
11 SASI_Hs01_00224818 predicted 1180
12 SASI_Hs01_00224820 predicted 1448
13 SASI_Hs01_00224821 predicted 575
14 SASI_Hs01_00224823 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080842 predicted 1333
2 SASI_Rn01_00080843 predicted 1129
3 SASI_Rn01_00080844 predicted 1324
4 SASI_Rn02_00262119 predicted 1469
5 SASI_Rn01_00080845 predicted 423
6 SASI_Rn01_00080846 predicted 1102
7 SASI_Rn01_00080847 predicted 523
8 SASI_Rn01_00080849 predicted 521
9 SASI_Rn01_00080850 predicted 475
10 SASI_Rn01_00080851 predicted 727
11 SASI_Rn01_00080848 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184638 predicted 1204
2 SASI_Rn01_00184639 predicted 229
3 SASI_Rn01_00184640 predicted 995
4 SASI_Rn01_00184641 predicted 1196
5 SASI_Rn01_00184642 predicted 997
6 SASI_Rn01_00184643 predicted 221
7 SASI_Rn01_00184644 predicted 1034
8 SASI_Rn01_00184645 predicted 1044
9 SASI_Rn01_00184646 predicted 216
10 SASI_Rn01_00184647 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144065 predicted 538
2 SASI_Mm01_00144066 predicted 481
3 SASI_Mm01_00144067 predicted 1380
4 SASI_Mm01_00144068 predicted 1130
5 SASI_Mm01_00144069 predicted 738
6 SASI_Mm01_00144070 predicted 1166
7 SASI_Mm01_00144071 predicted 794
8 SASI_Mm01_00144072 predicted 535
9 SASI_Mm01_00144073 predicted 848
10 SASI_Mm01_00144074 predicted 1344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005881
VALIDATED
BCKDK MISSION shRNA Bacterial Glycerol Stock
branched chain ketoacid dehydrogenase kinase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005881.2-1238s21c1
Sequence:CCGGGATCTGATCATCAGGATCTCACTCGAGTGAGATCCTGATGATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005881.2-893s21c1
Sequence:CCGGACGCTGACTTCGAGGCTTGGACTCGAGTCCAAGCCTCGAAGTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005881.2-871s21c1
Sequence:CCGGCGTCCGCTACTTCTTGGACAACTCGAGTTGTCCAAGAAGTAGCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005881.2-724s21c1
Sequence:CCGGGACAGACTTCCCTCCGATCAACTCGAGTTGATCGGAGGGAAGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005881.2-1780s21c1
Sequence:CCGGCCAGCACCAGTTCCGTCATTCCTCGAGGAATGACGGAACTGGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.x-1351s1c1
Sequence:CCGGTCAGGACCCATGCACGGCTTTCTCGAGAAAGCCGTGCATGGGTCCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005881.x-464s1c1
Sequence:CCGGAGAAGCCCTCAGTCCGCCTAACTCGAGTTAGGCGGACTGAGGGCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005881.x-681s1c1
Sequence:CCGGGACAGACTTCCCTCCGATCAACTCGAGTTGATCGGAGGGAAGTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.x-850s1c1
Sequence:CCGGACGCTGACTTCGAGGCTTGGACTCGAGTCCAAGCCTCGAAGTCAGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005881.1-1147s1c1
Sequence:CCGGCCCTACAATGTCCCAGATGTGCTCGAGCACATCTGGGACATTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.1-1740s1c1
Sequence:CCGGCCAGCACCAGTTCCGTCATTCCTCGAGGAATGACGGAACTGGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.1-1195s1c1
Sequence:CCGGGATCTGATCATCAGGATCTCACTCGAGTGAGATCCTGATGATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.1-828s1c1
Sequence:CCGGCGTCCGCTACTTCTTGGACAACTCGAGTTGTCCAAGAAGTAGCGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005881.1-1684s1c1
Sequence:CCGGCATTGCCTCTTGCCTCCAGAACTCGAGTTCTGGAGGCAAGAGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005881
VALIDATED
BCKDK MISSION shRNA shRNA Plasmid DNA
branched chain ketoacid dehydrogenase kinase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005881.2-1238s21c1
Sequence:CCGGGATCTGATCATCAGGATCTCACTCGAGTGAGATCCTGATGATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005881.2-893s21c1
Sequence:CCGGACGCTGACTTCGAGGCTTGGACTCGAGTCCAAGCCTCGAAGTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005881.2-871s21c1
Sequence:CCGGCGTCCGCTACTTCTTGGACAACTCGAGTTGTCCAAGAAGTAGCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005881.2-724s21c1
Sequence:CCGGGACAGACTTCCCTCCGATCAACTCGAGTTGATCGGAGGGAAGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005881.2-1780s21c1
Sequence:CCGGCCAGCACCAGTTCCGTCATTCCTCGAGGAATGACGGAACTGGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.x-1351s1c1
Sequence:CCGGTCAGGACCCATGCACGGCTTTCTCGAGAAAGCCGTGCATGGGTCCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005881.x-464s1c1
Sequence:CCGGAGAAGCCCTCAGTCCGCCTAACTCGAGTTAGGCGGACTGAGGGCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005881.x-681s1c1
Sequence:CCGGGACAGACTTCCCTCCGATCAACTCGAGTTGATCGGAGGGAAGTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.x-850s1c1
Sequence:CCGGACGCTGACTTCGAGGCTTGGACTCGAGTCCAAGCCTCGAAGTCAGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005881.1-1147s1c1
Sequence:CCGGCCCTACAATGTCCCAGATGTGCTCGAGCACATCTGGGACATTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.1-1740s1c1
Sequence:CCGGCCAGCACCAGTTCCGTCATTCCTCGAGGAATGACGGAACTGGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.1-1195s1c1
Sequence:CCGGGATCTGATCATCAGGATCTCACTCGAGTGAGATCCTGATGATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.1-828s1c1
Sequence:CCGGCGTCCGCTACTTCTTGGACAACTCGAGTTGTCCAAGAAGTAGCGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005881.1-1684s1c1
Sequence:CCGGCATTGCCTCTTGCCTCCAGAACTCGAGTTCTGGAGGCAAGAGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005881
VALIDATED
BCKDK MISSION shRNA Lentiviral Transduction Particles
branched chain ketoacid dehydrogenase kinase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005881.2-1238s21c1
Sequence:CCGGGATCTGATCATCAGGATCTCACTCGAGTGAGATCCTGATGATCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005881.2-893s21c1
Sequence:CCGGACGCTGACTTCGAGGCTTGGACTCGAGTCCAAGCCTCGAAGTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005881.2-871s21c1
Sequence:CCGGCGTCCGCTACTTCTTGGACAACTCGAGTTGTCCAAGAAGTAGCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005881.2-724s21c1
Sequence:CCGGGACAGACTTCCCTCCGATCAACTCGAGTTGATCGGAGGGAAGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005881.2-1780s21c1
Sequence:CCGGCCAGCACCAGTTCCGTCATTCCTCGAGGAATGACGGAACTGGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.x-1351s1c1
Sequence:CCGGTCAGGACCCATGCACGGCTTTCTCGAGAAAGCCGTGCATGGGTCCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005881.x-464s1c1
Sequence:CCGGAGAAGCCCTCAGTCCGCCTAACTCGAGTTAGGCGGACTGAGGGCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005881.x-681s1c1
Sequence:CCGGGACAGACTTCCCTCCGATCAACTCGAGTTGATCGGAGGGAAGTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.x-850s1c1
Sequence:CCGGACGCTGACTTCGAGGCTTGGACTCGAGTCCAAGCCTCGAAGTCAGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005881.1-1147s1c1
Sequence:CCGGCCCTACAATGTCCCAGATGTGCTCGAGCACATCTGGGACATTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199101    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.1-1740s1c1
Sequence:CCGGCCAGCACCAGTTCCGTCATTCCTCGAGGAATGACGGAACTGGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.1-1195s1c1
Sequence:CCGGGATCTGATCATCAGGATCTCACTCGAGTGAGATCCTGATGATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005881.1-828s1c1
Sequence:CCGGCGTCCGCTACTTCTTGGACAACTCGAGTTGTCCAAGAAGTAGCGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005881.1-1684s1c1
Sequence:CCGGCATTGCCTCTTGCCTCCAGAACTCGAGTTCTGGAGGCAAGAGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009739
VALIDATED
BCKDK MISSION shRNA Bacterial Glycerol Stock
branched chain ketoacid dehydrogenase kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009739.3-1470s21c1
Sequence:CCGGACATTGATGGTCGGGAGGAAACTCGAGTTTCCTCCCGACCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009739.3-821s21c1
Sequence:CCGGGTCCGGTACTTCTTGGATAAACTCGAGTTTATCCAAGAAGTACCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009739.3-403s21c1
Sequence:CCGGCTCCAAGACTGTCACCTCTTTCTCGAGAAAGAGGTGACAGTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009739.3-943s21c1
Sequence:CCGGGCCCAAGAAGATTATCGAGAACTCGAGTTCTCGATAATCTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009739.2-913s1c1
Sequence:CCGGGCCCAAGAAGATTATCGAGAACTCGAGTTCTCGATAATCTTCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009739.2-1440s1c1
Sequence:CCGGACATTGATGGTCGGGAGGAAACTCGAGTTTCCTCCCGACCATCAATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009739.2-373s1c1
Sequence:CCGGCTCCAAGACTGTCACCTCTTTCTCGAGAAAGAGGTGACAGTCTTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009739.2-791s1c1
Sequence:CCGGGTCCGGTACTTCTTGGATAAACTCGAGTTTATCCAAGAAGTACCGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009739
VALIDATED
BCKDK MISSION shRNA shRNA Plasmid DNA
branched chain ketoacid dehydrogenase kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009739.3-1470s21c1
Sequence:CCGGACATTGATGGTCGGGAGGAAACTCGAGTTTCCTCCCGACCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009739.3-821s21c1
Sequence:CCGGGTCCGGTACTTCTTGGATAAACTCGAGTTTATCCAAGAAGTACCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009739.3-403s21c1
Sequence:CCGGCTCCAAGACTGTCACCTCTTTCTCGAGAAAGAGGTGACAGTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009739.3-943s21c1
Sequence:CCGGGCCCAAGAAGATTATCGAGAACTCGAGTTCTCGATAATCTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009739.2-913s1c1
Sequence:CCGGGCCCAAGAAGATTATCGAGAACTCGAGTTCTCGATAATCTTCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009739.2-1440s1c1
Sequence:CCGGACATTGATGGTCGGGAGGAAACTCGAGTTTCCTCCCGACCATCAATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009739.2-373s1c1
Sequence:CCGGCTCCAAGACTGTCACCTCTTTCTCGAGAAAGAGGTGACAGTCTTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009739.2-791s1c1
Sequence:CCGGGTCCGGTACTTCTTGGATAAACTCGAGTTTATCCAAGAAGTACCGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009739
VALIDATED
BCKDK MISSION shRNA Lentiviral Transduction Particles
branched chain ketoacid dehydrogenase kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009739.3-1470s21c1
Sequence:CCGGACATTGATGGTCGGGAGGAAACTCGAGTTTCCTCCCGACCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009739.3-821s21c1
Sequence:CCGGGTCCGGTACTTCTTGGATAAACTCGAGTTTATCCAAGAAGTACCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009739.3-403s21c1
Sequence:CCGGCTCCAAGACTGTCACCTCTTTCTCGAGAAAGAGGTGACAGTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009739.3-943s21c1
Sequence:CCGGGCCCAAGAAGATTATCGAGAACTCGAGTTCTCGATAATCTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009739.2-913s1c1
Sequence:CCGGGCCCAAGAAGATTATCGAGAACTCGAGTTCTCGATAATCTTCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009739.2-1440s1c1
Sequence:CCGGACATTGATGGTCGGGAGGAAACTCGAGTTTCCTCCCGACCATCAATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009739.2-373s1c1
Sequence:CCGGCTCCAAGACTGTCACCTCTTTCTCGAGAAAGAGGTGACAGTCTTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009739.2-791s1c1
Sequence:CCGGGTCCGGTACTTCTTGGATAAACTCGAGTTTATCCAAGAAGTACCGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks