EMAIL THIS PAGE TO A FRIEND

BCL10

B-cell CLL/lymphoma 10

68 Gene Product Result for
Synonyms: CARMEN CIPER CLAP c-E10 mE10
UniProtKB ID: O95999, Q5VUF1
Gene ID:
Human(8915) Summary: This gene was identified by its translocation in a case of mucosa-associated lymphoid tissue (MALT) lymphoma. The protein encoded by this gene contains a caspase recruitment domain (CARD), and has been shown to induce apoptosis and to activate NF-kappaB. This protein is reported to interact with other CARD domain containing proteins including CARD9, 10, 11 and 14, which are thought to function as upstream regulators in NF-kappaB signaling. This protein is found to form a complex with MALT1, a protein encoded by another gene known to be translocated in MALT lymphoma. MALT1 and this protein are thought to synergize in the activation of NF-kappaB, and the deregulation of either of them may contribute to the same pathogenetic process that leads to the malignancy. [provided by RefSeq, Jul 2008]
Mouse(12042) B cell leukemia/lymphoma 10
Rat(83477) B-cell CLL/lymphoma 10
chicken(424528) B-cell CLL/lymphoma 10
cow(540824) B-cell CLL/lymphoma 10
domestic cat(101099570) B-cell CLL/lymphoma 10
dog(490183) B-cell CLL/lymphoma 10
sheep(101113372) B-cell CLL/lymphoma 10
naked mole-rat(101712563) B-cell CLL/lymphoma 10
domestic guinea pig(100729772) B-cell CLL/lymphoma 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B0306 Anti-Bcl-10 (AQ-18) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, rat
immunohistochemistry, immunoprecipitation, microarray, western blot pricing
B0431 Anti-Bcl-10 (MK-17) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunohistochemistry, immunoprecipitation, microarray, western blot pricing
SAB3500432 Anti-Bcl-10 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunocytochemistry, western blot pricing
SAB5500013 Anti-BCL-10 antibody, Rabbit monoclonal clone SP153, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
HPA017925 Anti-BCL10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4503504 Anti-BCL10 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
B7806 Monoclonal Anti-Bcl-10 antibody produced in mouse ~2 mg/mL, clone 151, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, microarray, western blot pricing
SAB4100129 Monoclonal Anti-BCL10 antibody produced in mouse clone BCL10-A111, culture supernatant human
western blot pricing
SAB5300529 Monoclonal Anti-BCL10 antibody produced in mouse clone 4F8, ascites fluid human, mouse
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003921 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003921 Rosetta Predictions human pricing
NM_031328 Rosetta Predictions rat pricing
NM_009740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172696 predicted 1317
2 SASI_Hs01_00172699 predicted 1377
3 SASI_Hs01_00172700 predicted 1146
4 SASI_Hs01_00172701 predicted 1381
5 SASI_Hs01_00172702 predicted 1362
6 SASI_Hs01_00172703 predicted 1363
7 SASI_Hs01_00172704 predicted 1342
8 SASI_Hs01_00172705 predicted 1073
9 SASI_Hs02_00336570 predicted 1373
10 SASI_Hs02_00336571 predicted 1147
11 SASI_Hs01_00172697 predicted 1233
12 SASI_Hs01_00172698 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033304 predicted 556
2 SASI_Rn02_00264548 predicted 559
3 SASI_Rn01_00033305 predicted 1306
4 SASI_Rn01_00033306 predicted 533
5 SASI_Rn01_00033307 predicted 1274
6 SASI_Rn01_00033308 predicted 519
7 SASI_Rn01_00033309 predicted 636
8 SASI_Rn01_00033310 predicted 1315
9 SASI_Rn01_00033311 predicted 735
10 SASI_Rn01_00033312 predicted 1294
11 SASI_Rn01_00033313 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072916 predicted 689
2 SASI_Mm01_00072917 predicted 524
3 SASI_Mm01_00072918 predicted 448
4 SASI_Mm01_00072919 predicted 487
5 SASI_Mm01_00072920 predicted 470
6 SASI_Mm01_00072921 predicted 385
7 SASI_Mm01_00072922 predicted 903
8 SASI_Mm02_00316907 predicted 895
9 SASI_Mm02_00316908 predicted 328
10 SASI_Mm02_00316909 predicted 914
11 SASI_Mm01_00072923 predicted 133
12 SASI_Mm01_00072924 predicted 393
13 SASI_Mm01_00072925 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009740
VALIDATED
BCL10 MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 10
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009740.1-1148s1c1
Sequence:CCGGCCCACTGATCTGGCAGTATATCTCGAGATATACTGCCAGATCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009740.1-752s1c1
Sequence:CCGGCCTTACGGTCACGGGCTCTTTCTCGAGAAAGAGCCCGTGACCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009740.1-285s1c1
Sequence:CCGGGTTAGACTACTTACAGGAGAACTCGAGTTCTCCTGTAAGTAGTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009740.1-154s1c1
Sequence:CCGGCGTGTTTACCTGTGTGAGAAACTCGAGTTTCTCACACAGGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009740.1-124s1c1
Sequence:CCGGGAAGTGAAGAAGGACGCTTTACTCGAGTAAAGCGTCCTTCTTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-1585s21c1
Sequence:GTACCGGATCCGTGTTCTTACTGCTTTACTCGAGTAAAGCAGTAAGAACACGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-1432s21c1
Sequence:CCGGGATACTTGTAATTGACTAAAGCTCGAGCTTTAGTCAATTACAAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-1340s21c1
Sequence:CCGGCAGCGTGAGTGTCTTACTTTCCTCGAGGAAAGTAAGACACTCACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-1149s21c1
Sequence:CCGGCCACTGATCTGGCAGTATATTCTCGAGAATATACTGCCAGATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-916s21c1
Sequence:CCGGATAGGATTTGTTAGGGTAAAGCTCGAGCTTTACCCTAACAAATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009740.1-154s21c1
Sequence:CCGGCGTGTTTACCTGTGTGAGAAACTCGAGTTTCTCACACAGGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009740
VALIDATED
BCL10 MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 10
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009740.1-1148s1c1
Sequence:CCGGCCCACTGATCTGGCAGTATATCTCGAGATATACTGCCAGATCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009740.1-752s1c1
Sequence:CCGGCCTTACGGTCACGGGCTCTTTCTCGAGAAAGAGCCCGTGACCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009740.1-285s1c1
Sequence:CCGGGTTAGACTACTTACAGGAGAACTCGAGTTCTCCTGTAAGTAGTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009740.1-154s1c1
Sequence:CCGGCGTGTTTACCTGTGTGAGAAACTCGAGTTTCTCACACAGGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009740.1-124s1c1
Sequence:CCGGGAAGTGAAGAAGGACGCTTTACTCGAGTAAAGCGTCCTTCTTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-1585s21c1
Sequence:GTACCGGATCCGTGTTCTTACTGCTTTACTCGAGTAAAGCAGTAAGAACACGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-1432s21c1
Sequence:CCGGGATACTTGTAATTGACTAAAGCTCGAGCTTTAGTCAATTACAAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-1340s21c1
Sequence:CCGGCAGCGTGAGTGTCTTACTTTCCTCGAGGAAAGTAAGACACTCACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-1149s21c1
Sequence:CCGGCCACTGATCTGGCAGTATATTCTCGAGAATATACTGCCAGATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-916s21c1
Sequence:CCGGATAGGATTTGTTAGGGTAAAGCTCGAGCTTTACCCTAACAAATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009740.1-154s21c1
Sequence:CCGGCGTGTTTACCTGTGTGAGAAACTCGAGTTTCTCACACAGGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009740
VALIDATED
BCL10 MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 10
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009740.1-1148s1c1
Sequence:CCGGCCCACTGATCTGGCAGTATATCTCGAGATATACTGCCAGATCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009740.1-752s1c1
Sequence:CCGGCCTTACGGTCACGGGCTCTTTCTCGAGAAAGAGCCCGTGACCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009740.1-285s1c1
Sequence:CCGGGTTAGACTACTTACAGGAGAACTCGAGTTCTCCTGTAAGTAGTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009740.1-154s1c1
Sequence:CCGGCGTGTTTACCTGTGTGAGAAACTCGAGTTTCTCACACAGGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009740.1-124s1c1
Sequence:CCGGGAAGTGAAGAAGGACGCTTTACTCGAGTAAAGCGTCCTTCTTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-1585s21c1
Sequence:GTACCGGATCCGTGTTCTTACTGCTTTACTCGAGTAAAGCAGTAAGAACACGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-1432s21c1
Sequence:CCGGGATACTTGTAATTGACTAAAGCTCGAGCTTTAGTCAATTACAAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-1340s21c1
Sequence:CCGGCAGCGTGAGTGTCTTACTTTCCTCGAGGAAAGTAAGACACTCACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-1149s21c1
Sequence:CCGGCCACTGATCTGGCAGTATATTCTCGAGAATATACTGCCAGATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234029    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009740.1-916s21c1
Sequence:CCGGATAGGATTTGTTAGGGTAAAGCTCGAGCTTTACCCTAACAAATCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009740.1-154s21c1
Sequence:CCGGCGTGTTTACCTGTGTGAGAAACTCGAGTTTCTCACACAGGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003921
VALIDATED
BCL10 MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003921.2-748s1c1
Sequence:CCGGGAAGTGAAGAAGGACGCCTTACTCGAGTAAGGCGTCCTTCTTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003921.2-1376s1c1
Sequence:CCGGCCTTAAGATCACGTACTGTTTCTCGAGAAACAGTACGTGATCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003921.2-1315s1c1
Sequence:CCGGCCACCAGATCTACAGTTAGAACTCGAGTTCTAACTGTAGATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003921.2-872s1c1
Sequence:CCGGCTTGTCGAACATCAAGTAGAACTCGAGTTCTACTTGATGTTCGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003921.2-952s1c1
Sequence:CCGGGTTGAATCTATTCGGCGAGAACTCGAGTTCTCGCCGAATAGATTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003921.3-1517s21c1
Sequence:CCGGATGCAATGTAAGCATACTTTGCTCGAGCAAAGTATGCTTACATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003921.3-1386s21c1
Sequence:CCGGACGTACTGTTTCACGACAATGCTCGAGCATTGTCGTGAAACAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003921.3-1767s21c1
Sequence:CCGGTCAAGAGTCTAATAGTCTTTGCTCGAGCAAAGACTATTAGACTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003921.3-1097s21c1
Sequence:CCGGACAACCTCTCCAGATCAAATTCTCGAGAATTTGATCTGGAGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003921
VALIDATED
BCL10 MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003921.2-748s1c1
Sequence:CCGGGAAGTGAAGAAGGACGCCTTACTCGAGTAAGGCGTCCTTCTTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003921.2-1376s1c1
Sequence:CCGGCCTTAAGATCACGTACTGTTTCTCGAGAAACAGTACGTGATCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003921.2-1315s1c1
Sequence:CCGGCCACCAGATCTACAGTTAGAACTCGAGTTCTAACTGTAGATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003921.2-872s1c1
Sequence:CCGGCTTGTCGAACATCAAGTAGAACTCGAGTTCTACTTGATGTTCGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003921.2-952s1c1
Sequence:CCGGGTTGAATCTATTCGGCGAGAACTCGAGTTCTCGCCGAATAGATTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003921.3-1517s21c1
Sequence:CCGGATGCAATGTAAGCATACTTTGCTCGAGCAAAGTATGCTTACATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003921.3-1386s21c1
Sequence:CCGGACGTACTGTTTCACGACAATGCTCGAGCATTGTCGTGAAACAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003921.3-1767s21c1
Sequence:CCGGTCAAGAGTCTAATAGTCTTTGCTCGAGCAAAGACTATTAGACTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003921.3-1097s21c1
Sequence:CCGGACAACCTCTCCAGATCAAATTCTCGAGAATTTGATCTGGAGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003921
VALIDATED
BCL10 MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003921.2-748s1c1
Sequence:CCGGGAAGTGAAGAAGGACGCCTTACTCGAGTAAGGCGTCCTTCTTCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003921.2-1376s1c1
Sequence:CCGGCCTTAAGATCACGTACTGTTTCTCGAGAAACAGTACGTGATCTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003921.2-1315s1c1
Sequence:CCGGCCACCAGATCTACAGTTAGAACTCGAGTTCTAACTGTAGATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003921.2-872s1c1
Sequence:CCGGCTTGTCGAACATCAAGTAGAACTCGAGTTCTACTTGATGTTCGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003921.2-952s1c1
Sequence:CCGGGTTGAATCTATTCGGCGAGAACTCGAGTTCTCGCCGAATAGATTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359327    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_003921.3-1517s21c1
Sequence:CCGGATGCAATGTAAGCATACTTTGCTCGAGCAAAGTATGCTTACATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_003921.3-1386s21c1
Sequence:CCGGACGTACTGTTTCACGACAATGCTCGAGCATTGTCGTGAAACAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003921.3-1767s21c1
Sequence:CCGGTCAAGAGTCTAATAGTCTTTGCTCGAGCAAAGACTATTAGACTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003921.3-1097s21c1
Sequence:CCGGACAACCTCTCCAGATCAAATTCTCGAGAATTTGATCTGGAGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks