EMAIL THIS PAGE TO A FRIEND

BCL11B

B-cell CLL/lymphoma 11B (zinc finger protein)

349 Gene Product Result for
Synonyms: ATL1 ATL1-alpha ATL1-beta ATL1-delta ATL1-gamma CTIP-2 CTIP2 RIT1 ZNF856B hRIT1-alpha
UniProtKB ID: Q9C0K0, Q9H162
Gene ID:
Human(64919) Summary: This gene encodes a C2H2-type zinc finger protein and is closely related to BCL11A, a gene whose translocation may be associated with B-cell malignancies. The specific function of this gene has not yet been determined. Two alternatively spliced transcript variants, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
Mouse(58208) B cell leukemia/lymphoma 11B
Rat(314423) B-cell CLL/lymphoma 11B (zinc finger protein)
chicken(423444) B-cell CLL/lymphoma 11B (zinc finger protein)
cow(783269) B-cell CLL/lymphoma 11B (zinc finger protein)
domestic cat(101092121) B-cell CLL/lymphoma 11B (zinc finger protein)
dog(612476) B-cell CLL/lymphoma 11B (zinc finger protein)
sheep(101116868) B-cell CLL/lymphoma 11B (zinc finger protein)
Domestic Rabbit(100328694) B-cell CLL/lymphoma 11B (zinc finger protein)
naked mole-rat(101712090) B-cell CLL/lymphoma 11B (zinc finger protein)
domestic guinea pig(100728663) B-cell CLL/lymphoma 11B (zinc finger protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022898 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022898 Rosetta Predictions human pricing
NM_138576 Rosetta Predictions human pricing
NM_001108057 Rosetta Predictions rat pricing
NM_001079883 Rosetta Predictions mouse pricing
NM_021399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214269 predicted 508
2 SASI_Hs01_00214270 predicted 671
3 SASI_Hs01_00214271 predicted 2556
4 SASI_Hs01_00214273 predicted 430
5 SASI_Hs01_00214274 predicted 3207
6 SASI_Hs01_00214275 predicted 2882
7 SASI_Hs02_00356185 predicted 664
8 SASI_Hs01_00214276 predicted 422
9 SASI_Hs01_00214277 predicted 2868
10 SASI_Hs02_00356186 predicted 2624
11 SASI_Hs01_00214268 predicted 1217
12 SASI_Hs01_00214272 predicted 3217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177021 predicted 509
2 SASI_Hs01_00177022 predicted 2772
3 SASI_Hs01_00177024 predicted 432
4 SASI_Hs01_00177025 predicted 877
5 SASI_Hs02_00363731 predicted 3422
6 SASI_Hs01_00177026 predicted 3093
7 SASI_Hs02_00363732 predicted 660
8 SASI_Hs01_00177027 predicted 3086
9 SASI_Hs01_00177028 predicted 2840
10 SASI_Hs01_00177029 predicted 752
11 SASI_Hs01_00177020 predicted 1425
12 SASI_Hs01_00177023 predicted 3436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234925 predicted 1158
2 SASI_Rn02_00234926 predicted 2900
3 SASI_Rn02_00234927 predicted 890
4 SASI_Rn02_00234928 predicted 3256
5 SASI_Rn02_00234929 predicted 3106
6 SASI_Rn02_00234930 predicted 3374
7 SASI_Rn02_00234931 predicted 3398
8 SASI_Rn02_00234932 predicted 677
9 SASI_Rn02_00234933 predicted 3385
10 SASI_Rn02_00234934 predicted 3140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293192 predicted 2743
2 SASI_Mm02_00293193 predicted 2883
3 SASI_Mm02_00293194 predicted 1132
4 SASI_Mm02_00293195 predicted 2871
5 SASI_Mm02_00293196 predicted 1331
6 SASI_Mm02_00293197 predicted 2349
7 SASI_Mm02_00293198 predicted 1560
8 SASI_Mm02_00293199 predicted 2814
9 SASI_Mm02_00293200 predicted 2826
10 SASI_Mm02_00293201 predicted 2786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326006 predicted 2522
2 SASI_Mm01_00156683 predicted 2666
3 SASI_Mm01_00156684 predicted 916
4 SASI_Mm01_00156686 predicted 2652
5 SASI_Mm02_00326007 predicted 2650
6 SASI_Mm01_00156689 predicted 2126
7 SASI_Mm02_00326008 predicted 2652
8 SASI_Mm01_00156690 predicted 1343
9 SASI_Mm01_00156691 predicted 2591
10 SASI_Mm01_00156692 predicted 2609
11 SASI_Mm01_00156685 predicted 414
12 SASI_Mm01_00156687 predicted 487
13 SASI_Mm01_00156688 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021399
BCL11B MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 11B (zinc finger protein)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-2466s1c1
Sequence:CCGGCGGTGAACACTTGCTGACTAACTCGAGTTAGTCAGCAAGTGTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-485s1c1
Sequence:CCGGGCAGGAGAACATTGCAGGTAACTCGAGTTACCTGCAATGTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-2055s1c1
Sequence:CCGGGTCGGAACATTCCTCTGAGAACTCGAGTTCTCAGAGGAATGTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-489s1c1
Sequence:CCGGGAGAACATTGCAGGTAAAGATCTCGAGATCTTTACCTGCAATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-436s1c1
Sequence:CCGGCCTGATGAAGATGACCACCTACTCGAGTAGGTGGTCATCTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021399.2-7309s21c1
Sequence:CCGGTACTGGCAAGGCGGAATATTTCTCGAGAAATATTCCGCCTTGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021399.2-2604s21c1
Sequence:CCGGAGATGCCCTTCAGCGTCTACACTCGAGTGTAGACGCTGAAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021399.2-703s21c1
Sequence:CCGGTGAGCCTTCCAGCTACATTTGCTCGAGCAAATGTAGCTGGAAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021399.2-1360s21c1
Sequence:CCGGCAAGTTCCAGAGCAATCTCATCTCGAGATGAGATTGCTCTGGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021399.2-2698s21c1
Sequence:CCGGTGAGAGGAGCTAAGCGCATACCTCGAGGTATGCGCTTAGCTCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021399
BCL11B MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 11B (zinc finger protein)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-2466s1c1
Sequence:CCGGCGGTGAACACTTGCTGACTAACTCGAGTTAGTCAGCAAGTGTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-485s1c1
Sequence:CCGGGCAGGAGAACATTGCAGGTAACTCGAGTTACCTGCAATGTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-2055s1c1
Sequence:CCGGGTCGGAACATTCCTCTGAGAACTCGAGTTCTCAGAGGAATGTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-489s1c1
Sequence:CCGGGAGAACATTGCAGGTAAAGATCTCGAGATCTTTACCTGCAATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-436s1c1
Sequence:CCGGCCTGATGAAGATGACCACCTACTCGAGTAGGTGGTCATCTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021399.2-7309s21c1
Sequence:CCGGTACTGGCAAGGCGGAATATTTCTCGAGAAATATTCCGCCTTGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021399.2-2604s21c1
Sequence:CCGGAGATGCCCTTCAGCGTCTACACTCGAGTGTAGACGCTGAAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021399.2-703s21c1
Sequence:CCGGTGAGCCTTCCAGCTACATTTGCTCGAGCAAATGTAGCTGGAAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021399.2-1360s21c1
Sequence:CCGGCAAGTTCCAGAGCAATCTCATCTCGAGATGAGATTGCTCTGGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021399.2-2698s21c1
Sequence:CCGGTGAGAGGAGCTAAGCGCATACCTCGAGGTATGCGCTTAGCTCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021399
BCL11B MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 11B (zinc finger protein)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-2466s1c1
Sequence:CCGGCGGTGAACACTTGCTGACTAACTCGAGTTAGTCAGCAAGTGTTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-485s1c1
Sequence:CCGGGCAGGAGAACATTGCAGGTAACTCGAGTTACCTGCAATGTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-2055s1c1
Sequence:CCGGGTCGGAACATTCCTCTGAGAACTCGAGTTCTCAGAGGAATGTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-489s1c1
Sequence:CCGGGAGAACATTGCAGGTAAAGATCTCGAGATCTTTACCTGCAATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021399.1-436s1c1
Sequence:CCGGCCTGATGAAGATGACCACCTACTCGAGTAGGTGGTCATCTTCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021399.2-7309s21c1
Sequence:CCGGTACTGGCAAGGCGGAATATTTCTCGAGAAATATTCCGCCTTGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021399.2-2604s21c1
Sequence:CCGGAGATGCCCTTCAGCGTCTACACTCGAGTGTAGACGCTGAAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021399.2-703s21c1
Sequence:CCGGTGAGCCTTCCAGCTACATTTGCTCGAGCAAATGTAGCTGGAAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021399.2-1360s21c1
Sequence:CCGGCAAGTTCCAGAGCAATCTCATCTCGAGATGAGATTGCTCTGGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021399.2-2698s21c1
Sequence:CCGGTGAGAGGAGCTAAGCGCATACCTCGAGGTATGCGCTTAGCTCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022898
BCL11B MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 11B (zinc finger protein)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-710s1c1
Sequence:CCGGCCAGCTACATTTGCACAACATCTCGAGATGTTGTGCAAATGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-2685s1c1
Sequence:CCGGCGGCGAGCACTTGCTGACTAACTCGAGTTAGTCAGCAAGTGCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-1836s1c1
Sequence:CCGGGCTGGGCAAGGTCATGGAGAACTCGAGTTCTCCATGACCTTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-2466s1c1
Sequence:CCGGGTTCAAGAACTGCAGCAACTTCTCGAGAAGTTGCTGCAGTTCTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-679s1c1
Sequence:CCGGCAGGAGAACATTGCAGGTAAACTCGAGTTTACCTGCAATGTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-1712s21c1
Sequence:CCGGAGTCGAGCTTCAGCATGGACTCTCGAGAGTCCATGCTGAAGCTCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022898.1-2901s21c1
Sequence:CCGGTGGAAACCCGAGGGTTGATTACTCGAGTAATCAACCCTCGGGTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-2580s21c1
Sequence:CCGGCATGAAGACGCACGGGCAGATCTCGAGATCTGCCCGTGCGTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-1364s21c1
Sequence:CCGGAGTTCCAGAGCAATCTCATCGCTCGAGCGATGAGATTGCTCTGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022898.1-3106s21c1
Sequence:CCGGATGACTCGCAAGCAATGTTAGCTCGAGCTAACATTGCTTGCGAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-2159s21c1
Sequence:CCGGTCCCGTCCGAGAACGTGTACTCTCGAGAGTACACGTTCTCGGACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-1328s21c1
Sequence:CCGCAGAGCAAGTCGTGCGAGTTCTCTCGAGAGAACTCGCACGACTTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-2631s21c1
Sequence:CCGGCCAGATGCCCTTCAGCGTCTACTCGAGTAGACGCTGAAGGGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022898
BCL11B MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 11B (zinc finger protein)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-710s1c1
Sequence:CCGGCCAGCTACATTTGCACAACATCTCGAGATGTTGTGCAAATGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-2685s1c1
Sequence:CCGGCGGCGAGCACTTGCTGACTAACTCGAGTTAGTCAGCAAGTGCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-1836s1c1
Sequence:CCGGGCTGGGCAAGGTCATGGAGAACTCGAGTTCTCCATGACCTTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-2466s1c1
Sequence:CCGGGTTCAAGAACTGCAGCAACTTCTCGAGAAGTTGCTGCAGTTCTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-679s1c1
Sequence:CCGGCAGGAGAACATTGCAGGTAAACTCGAGTTTACCTGCAATGTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-1712s21c1
Sequence:CCGGAGTCGAGCTTCAGCATGGACTCTCGAGAGTCCATGCTGAAGCTCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022898.1-2901s21c1
Sequence:CCGGTGGAAACCCGAGGGTTGATTACTCGAGTAATCAACCCTCGGGTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-2580s21c1
Sequence:CCGGCATGAAGACGCACGGGCAGATCTCGAGATCTGCCCGTGCGTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-1364s21c1
Sequence:CCGGAGTTCCAGAGCAATCTCATCGCTCGAGCGATGAGATTGCTCTGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022898.1-3106s21c1
Sequence:CCGGATGACTCGCAAGCAATGTTAGCTCGAGCTAACATTGCTTGCGAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-2159s21c1
Sequence:CCGGTCCCGTCCGAGAACGTGTACTCTCGAGAGTACACGTTCTCGGACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-1328s21c1
Sequence:CCGCAGAGCAAGTCGTGCGAGTTCTCTCGAGAGAACTCGCACGACTTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-2631s21c1
Sequence:CCGGCCAGATGCCCTTCAGCGTCTACTCGAGTAGACGCTGAAGGGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022898
BCL11B MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 11B (zinc finger protein)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-710s1c1
Sequence:CCGGCCAGCTACATTTGCACAACATCTCGAGATGTTGTGCAAATGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-2685s1c1
Sequence:CCGGCGGCGAGCACTTGCTGACTAACTCGAGTTAGTCAGCAAGTGCTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-1836s1c1
Sequence:CCGGGCTGGGCAAGGTCATGGAGAACTCGAGTTCTCCATGACCTTGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-2466s1c1
Sequence:CCGGGTTCAAGAACTGCAGCAACTTCTCGAGAAGTTGCTGCAGTTCTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022898.1-679s1c1
Sequence:CCGGCAGGAGAACATTGCAGGTAAACTCGAGTTTACCTGCAATGTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-1712s21c1
Sequence:CCGGAGTCGAGCTTCAGCATGGACTCTCGAGAGTCCATGCTGAAGCTCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022898.1-2901s21c1
Sequence:CCGGTGGAAACCCGAGGGTTGATTACTCGAGTAATCAACCCTCGGGTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-2580s21c1
Sequence:CCGGCATGAAGACGCACGGGCAGATCTCGAGATCTGCCCGTGCGTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-1364s21c1
Sequence:CCGGAGTTCCAGAGCAATCTCATCGCTCGAGCGATGAGATTGCTCTGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022898.1-3106s21c1
Sequence:CCGGATGACTCGCAAGCAATGTTAGCTCGAGCTAACATTGCTTGCGAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-2159s21c1
Sequence:CCGGTCCCGTCCGAGAACGTGTACTCTCGAGAGTACACGTTCTCGGACGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-1328s21c1
Sequence:CCGCAGAGCAAGTCGTGCGAGTTCTCTCGAGAGAACTCGCACGACTTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022898.1-2631s21c1
Sequence:CCGGCCAGATGCCCTTCAGCGTCTACTCGAGTAGACGCTGAAGGGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks