EMAIL THIS PAGE TO A FRIEND

BCL2

B-cell CLL/lymphoma 2

372 Gene Product Result for
Synonyms: Bcl-2 PPP1R50
UniProtKB ID: P10415, P10416, Q13842, Q16197
Gene ID:
Human(596) Summary: This gene encodes an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Two transcript variants, produced by alternate splicing, differ in their C-terminal ends. [provided by RefSeq, Jul 2008]
Mouse(12043) B cell leukemia/lymphoma 2
Rat(24224) B-cell CLL/lymphoma 2
Zebrafish(570772) B-cell leukemia/lymphoma 2
dog(403416) B-cell CLL/lymphoma 2
domestic cat(493934) B-cell CLL/lymphoma 2
cow(281020) B-cell CLL/lymphoma 2
chicken(396282) B-cell CLL/lymphoma 2
domestic guinea pig(100733337) B cell leukemia/lymphoma 2
naked mole-rat(101701667) B-cell CLL/lymphoma 2
Goat(100861254) B-cell CLL/lymphoma 2
sheep(101119602) B-cell CLL/lymphoma 2
sheep(494190) B-cell CLL/lymphoma 2
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS3335 Anti-Bcl-2 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS3337 Anti-Bcl-2 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, western blot pricing
SAB1305653 ANTI-BCL-2 (BH3 DOMAIN SPECIFIC) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306719 ANTI-BCL-2 (CENTER SER70) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB5500014 Anti-BCL-2 Alpha antibody, Rabbit monoclonal clone SP66, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB4500003 Anti-BCL-2 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4500005 Anti-BCL-2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4500006 Anti-BCL-2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
B9804 Anti-Bcl-2 antibody, Mouse monoclonal clone 10C4, purified from hybridoma cell culture mouse, rat
microarray, western blot pricing
SAB4300339 Anti-BCL2 (Ab-56) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300340 Anti-BCL2 (Ab-70) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2500154 Anti-BCL2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
AV01005 Anti-BCL2 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
HPA055295 Anti-BCL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4504350 Anti-phospho-BCL-2 (pSer70) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4503899 Anti-phospho-BCL-2 (pSer87) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301440 Anti-phospho-BCL-2 (pSer87) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504351 Anti-phospho-BCL-2 (pThr56) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504082 Anti-phospho-BCL-2 (pThr69) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4301532 Anti-phospho-BCL-2 (pThr69) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1306605 ANTI-PHOSPHO-BCL-2(S70) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1305613 ANTI-PHOSPHO-BCL-2(T56) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB4504751 Anti-phospho-BCL2 (pSer70) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
B3170 Monoclonal Anti-Bcl-2 antibody produced in mouse clone Bcl-2-100, ascites fluid human
electron microscopy, immunocytochemistry, immunohistochemistry, immunoprecipitation, microarray, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
G8761 (±)-Gossypol from cotton seeds ≥95% (HPLC) human pricing
H8787 HA 14-1 ≥95% (CHN/NMR), powder human, mouse, rat pricing

ELISA

Product # Description Species Add to Cart
 
CS0530 phospho-Bcl-2 (pSer70) ELISA human sufficient for 96 determinations human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0574 AQUA Peptide GAAPPG[V]TR human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000633 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009741 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009741 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009741 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000633 Rosetta Predictions human pricing
NM_000657 Rosetta Predictions human pricing
NM_016993 Rosetta Predictions rat pricing
NM_009741 Rosetta Predictions mouse pricing
NM_177410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119086 predicted 1678
2 SASI_Hs01_00119087 predicted 923
3 SASI_Hs01_00119088 predicted 1188
4 SASI_Hs02_00302981 predicted 529
5 SASI_Hs02_00302982 predicted 1245
6 SASI_Hs01_00119090 predicted 528
7 SASI_Hs02_00302983 predicted 1674
8 SASI_Hs01_00119091 predicted 1251
9 SASI_Hs01_00119094 predicted 1178
10 SASI_Hs01_00119095 predicted 1192
11 SASI_Hs01_00119089 predicted 1281
12 SASI_Hs01_00119092 predicted 515
13 SASI_Hs01_00119093 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149364 predicted 922
2 SASI_Hs01_00149365 predicted 530
3 SASI_Hs01_00149366 predicted 1067
4 SASI_Hs01_00149367 predicted 527
5 SASI_Hs01_00149368 predicted 509
6 SASI_Hs01_00149369 predicted 539
7 SASI_Hs01_00149370 predicted 531
8 SASI_Hs01_00149371 predicted 500
9 SASI_Hs01_00149372 predicted 815
10 SASI_Hs01_00149373 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062026 predicted 742
2 SASI_Rn01_00062027 predicted 655
3 SASI_Rn01_00062028 predicted 270
4 SASI_Rn01_00062029 predicted 757
5 SASI_Rn01_00062030 predicted 314
6 SASI_Rn01_00062031 predicted 653
7 SASI_Rn01_00062032 predicted 261
8 SASI_Rn01_00062033 predicted 555
9 SASI_Rn01_00062034 predicted 809
10 SASI_Rn01_00062035 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009741 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021754 predicted 1608
2 SASI_Mm02_00316910 predicted 1658
3 SASI_Mm01_00021756 predicted 1723
4 SASI_Mm01_00021758 predicted 1755
5 SASI_Mm02_00316911 predicted 1586
6 SASI_Mm01_00021761 predicted 1725
7 SASI_Mm01_00021762 predicted 1487
8 SASI_Mm01_00021763 predicted 2385
9 SASI_Mm02_00316912 predicted 2078
10 SASI_Mm02_00316913 predicted 2104
11 SASI_Mm01_00021755 predicted 1454
12 SASI_Mm01_00021757 predicted 1451
13 SASI_Mm01_00021759 predicted 1369
14 SASI_Mm01_00021760 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116143 predicted 1599
2 SASI_Mm02_00347624 predicted 1653
3 SASI_Mm01_00116145 predicted 1723
4 SASI_Mm01_00116147 predicted 1761
5 SASI_Mm02_00347625 predicted 1581
6 SASI_Mm01_00116150 predicted 1721
7 SASI_Mm01_00116151 predicted 1490
8 SASI_Mm02_00347626 predicted 2258
9 SASI_Mm02_00347627 predicted 2128
10 SASI_Mm02_00347628 predicted 1835
11 SASI_Mm01_00116144 predicted 1457
12 SASI_Mm01_00116146 predicted 1450
13 SASI_Mm01_00116148 predicted 1370
14 SASI_Mm01_00116149 predicted 1452
15 SASI_Mm01_00116152 predicted 1231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000633
VALIDATED
BCL2 MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000633.2-1048s21c1
Sequence:CCGGGCACACCTGGATCCAGGATAACTCGAGTTATCCTGGATCCAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000633.2-1019s21c1
Sequence:CCGGTGGATGACTGAGTACCTGAACCTCGAGGTTCAGGTACTCAGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000633.2-536s21c1
Sequence:CCGGGTGATGAAGTACATCCATTATCTCGAGATAATGGATGTACTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000633.2-1505s21c1
Sequence:CCGGTGGAAATCCGACCACTAATTGCTCGAGCAATTAGTGGTCGGATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000633.x-5594s1c1
Sequence:CCGGAGAGTGACAGTGGATTGCATTCTCGAGAATGCAATCCACTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000633.1-2872s1c1
Sequence:CCGGCCGCATTTAATTCATGGTATTCTCGAGAATACCATGAATTAAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000633.1-64s1c1
Sequence:CCGGCCGGGAGATAGTGATGAAGTACTCGAGTACTTCATCACTATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000633.1-74s1c1
Sequence:CCGGGTGATGAAGTACATCCATTATCTCGAGATAATGGATGTACTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000633
VALIDATED
BCL2 MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000633.2-1048s21c1
Sequence:CCGGGCACACCTGGATCCAGGATAACTCGAGTTATCCTGGATCCAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000633.2-1019s21c1
Sequence:CCGGTGGATGACTGAGTACCTGAACCTCGAGGTTCAGGTACTCAGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000633.2-536s21c1
Sequence:CCGGGTGATGAAGTACATCCATTATCTCGAGATAATGGATGTACTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000633.2-1505s21c1
Sequence:CCGGTGGAAATCCGACCACTAATTGCTCGAGCAATTAGTGGTCGGATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000633.x-5594s1c1
Sequence:CCGGAGAGTGACAGTGGATTGCATTCTCGAGAATGCAATCCACTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000633.1-2872s1c1
Sequence:CCGGCCGCATTTAATTCATGGTATTCTCGAGAATACCATGAATTAAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000633.1-64s1c1
Sequence:CCGGCCGGGAGATAGTGATGAAGTACTCGAGTACTTCATCACTATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000633.1-74s1c1
Sequence:CCGGGTGATGAAGTACATCCATTATCTCGAGATAATGGATGTACTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000633
VALIDATED
BCL2 MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000633.2-1048s21c1
Sequence:CCGGGCACACCTGGATCCAGGATAACTCGAGTTATCCTGGATCCAGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000633.2-1019s21c1
Sequence:CCGGTGGATGACTGAGTACCTGAACCTCGAGGTTCAGGTACTCAGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000633.2-536s21c1
Sequence:CCGGGTGATGAAGTACATCCATTATCTCGAGATAATGGATGTACTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000633.2-1505s21c1
Sequence:CCGGTGGAAATCCGACCACTAATTGCTCGAGCAATTAGTGGTCGGATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000633.x-5594s1c1
Sequence:CCGGAGAGTGACAGTGGATTGCATTCTCGAGAATGCAATCCACTGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000633.1-2872s1c1
Sequence:CCGGCCGCATTTAATTCATGGTATTCTCGAGAATACCATGAATTAAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000633.1-64s1c1
Sequence:CCGGCCGGGAGATAGTGATGAAGTACTCGAGTACTTCATCACTATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000633.1-74s1c1
Sequence:CCGGGTGATGAAGTACATCCATTATCTCGAGATAATGGATGTACTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009741
VALIDATED
BCL2 MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009741.3-1448s21c1
Sequence:GTACCGGAGATCGTGATGAAGTACATACCTCGAGGTATGTACTTCATCACGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009741.3-5516s21c1
Sequence:CCGGCATAAGCCAGGAGGGATTATACTCGAGTATAATCCCTCCTGGCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009741.3-2112s21c1
Sequence:CCGGCCACAAGTGAGGTCGACAAACCTCGAGGTTTGTCGACCTCACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009741.3-2016s21c1
Sequence:CCGGCATGCGACCTCTGTTTGATTTCTCGAGAAATCAAACAGAGGTCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009741.3-1986s21c1
Sequence:CCGGGGATGCCTTTGTGGAACTATACTCGAGTATAGTTCCACAAAGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009741.1-37s1c1
Sequence:CCGGGAGATCGTGATGAAGTACATACTCGAGTATGTACTTCATCACGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009741.1-516s1c1
Sequence:CCGGGTGGATGACTGAGTACCTGAACTCGAGTTCAGGTACTCAGTCATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009741.1-42s1c1
Sequence:CCGGCGTGATGAAGTACATACATTACTCGAGTAATGTATGTACTTCATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009741.1-546s1c1
Sequence:CCGGGCACACCTGGATCCAGGATAACTCGAGTTATCCTGGATCCAGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009741
VALIDATED
BCL2 MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009741.3-1448s21c1
Sequence:GTACCGGAGATCGTGATGAAGTACATACCTCGAGGTATGTACTTCATCACGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009741.3-5516s21c1
Sequence:CCGGCATAAGCCAGGAGGGATTATACTCGAGTATAATCCCTCCTGGCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009741.3-2112s21c1
Sequence:CCGGCCACAAGTGAGGTCGACAAACCTCGAGGTTTGTCGACCTCACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009741.3-2016s21c1
Sequence:CCGGCATGCGACCTCTGTTTGATTTCTCGAGAAATCAAACAGAGGTCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009741.3-1986s21c1
Sequence:CCGGGGATGCCTTTGTGGAACTATACTCGAGTATAGTTCCACAAAGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009741.1-37s1c1
Sequence:CCGGGAGATCGTGATGAAGTACATACTCGAGTATGTACTTCATCACGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009741.1-516s1c1
Sequence:CCGGGTGGATGACTGAGTACCTGAACTCGAGTTCAGGTACTCAGTCATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009741.1-42s1c1
Sequence:CCGGCGTGATGAAGTACATACATTACTCGAGTAATGTATGTACTTCATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009741.1-546s1c1
Sequence:CCGGGCACACCTGGATCCAGGATAACTCGAGTTATCCTGGATCCAGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009741
VALIDATED
BCL2 MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009741.3-1448s21c1
Sequence:GTACCGGAGATCGTGATGAAGTACATACCTCGAGGTATGTACTTCATCACGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009741.3-5516s21c1
Sequence:CCGGCATAAGCCAGGAGGGATTATACTCGAGTATAATCCCTCCTGGCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009741.3-2112s21c1
Sequence:CCGGCCACAAGTGAGGTCGACAAACCTCGAGGTTTGTCGACCTCACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009741.3-2016s21c1
Sequence:CCGGCATGCGACCTCTGTTTGATTTCTCGAGAAATCAAACAGAGGTCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009741.3-1986s21c1
Sequence:CCGGGGATGCCTTTGTGGAACTATACTCGAGTATAGTTCCACAAAGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009741.1-37s1c1
Sequence:CCGGGAGATCGTGATGAAGTACATACTCGAGTATGTACTTCATCACGATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009741.1-516s1c1
Sequence:CCGGGTGGATGACTGAGTACCTGAACTCGAGTTCAGGTACTCAGTCATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009741.1-42s1c1
Sequence:CCGGCGTGATGAAGTACATACATTACTCGAGTAATGTATGTACTTCATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009741.1-546s1c1
Sequence:CCGGGCACACCTGGATCCAGGATAACTCGAGTTATCCTGGATCCAGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks