EMAIL THIS PAGE TO A FRIEND

BCL2A1

BCL2-related protein A1

Synonyms: ACC-1 ACC-2 BCL2L5 BFL1 GRS HBPA1
UniProtKB ID: Q16548, Q6FGZ4, Q6FH19, Q86W13, Q99524
Gene ID:
Human(597) Summary: This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators that are involved in a wide variety of cellular activities such as embryonic development, homeostasis and tumorigenesis. The protein encoded by this gene is able to reduce the release of pro-apoptotic cytochrome c from mitochondria and block caspase activation. This gene is a direct transcription target of NF-kappa B in response to inflammatory mediators, and is up-regulated by different extracellular signals, such as granulocyte-macrophage colony-stimulating factor (GM-CSF), CD40, phorbol ester and inflammatory cytokine TNF and IL-1, which suggests a cytoprotective function that is essential for lymphocyte activation as well as cell survival. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Rat(170929) BCL2-related protein A1
sheep(101114560) BCL2-related protein A1
naked mole-rat(101702935) BCL2-related protein A1
domestic guinea pig(100732983) BCL2-related protein A1
chicken(395673) BCL2-related protein A1
cow(282151) BCL2-related protein A1
domestic cat(101086480) BCL2-related protein A1
domestic cat(768283) BCL2-related protein A1
dog(488770) BCL2-related protein A1
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004049 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100801 MISSION® esiRNA esiRNA human BCL2A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114735 Rosetta Predictions human pricing
NM_004049 Rosetta Predictions human pricing
NM_133416 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326784 predicted 255
2 SASI_Hs02_00326785 predicted 335
3 SASI_Hs02_00326786 predicted 293
4 SASI_Hs02_00326787 predicted 293
5 SASI_Hs02_00326788 predicted 348
6 SASI_Hs02_00326789 predicted 357
7 SASI_Hs02_00326790 predicted 341
8 SASI_Hs02_00326791 predicted 339
9 SASI_Hs02_00326792 predicted 368
10 SASI_Hs02_00326793 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336810 predicted 254
2 SASI_Hs02_00336811 predicted 332
3 SASI_Hs01_00186540 predicted 299
4 SASI_Hs02_00336812 predicted 292
5 SASI_Hs02_00336813 predicted 351
6 SASI_Hs02_00336814 predicted 359
7 SASI_Hs02_00336815 predicted 347
8 SASI_Hs02_00336816 predicted 337
9 SASI_Hs01_00186547 predicted 369
10 SASI_Hs02_00336817 predicted 225
11 SASI_Hs01_00186538 predicted 256
12 SASI_Hs01_00186539 predicted 461
13 SASI_Hs01_00186541 predicted 490
14 SASI_Hs01_00186542 predicted 554
15 SASI_Hs01_00186543 predicted 627
16 SASI_Hs01_00186544 predicted 459
17 SASI_Hs01_00186545 predicted 513
18 SASI_Hs01_00186546 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117008 predicted 204
2 SASI_Rn01_00117010 predicted 276
3 SASI_Rn01_00117011 predicted 340
4 SASI_Rn01_00117012 predicted 402
5 SASI_Rn01_00117013 predicted 444
6 SASI_Rn01_00117014 predicted 464
7 SASI_Rn01_00117015 predicted 439
8 SASI_Rn01_00117016 predicted 378
9 SASI_Rn02_00267672 predicted 401
10 SASI_Rn01_00117017 predicted 380
11 SASI_Rn01_00117009 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004049
VALIDATED
BCL2A1 MISSION shRNA Bacterial Glycerol Stock
BCL2-related protein A1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004049.2-382s1c1
Sequence:CCGGGCCAGAACACTATTCAACCAACTCGAGTTGGTTGAATAGTGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004049.2-469s1c1
Sequence:CCGGGAAGGTATTCTCATCAAGAAACTCGAGTTTCTTGATGAGAATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004049.2-415s1c1
Sequence:CCGGGAGTTTGAAGACGGCATCATTCTCGAGAATGATGCCGTCTTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004049.2-238s1c1
Sequence:CCGGTGCGTCCTACAGATACCACAACTCGAGTTGTGGTATCTGTAGGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004049.2-547s1c1
Sequence:CCGGGTTGCGGAGTTCATAATGAATCTCGAGATTCATTATGAACTCCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004049.3-414s21c1
Sequence:CCGGGAGTTTGAAGACGGCATCATTCTCGAGAATGATGCCGTCTTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004049.3-546s21c1
Sequence:CCGGGTTGCGGAGTTCATAATGAATCTCGAGATTCATTATGAACTCCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004049.3-237s21c1
Sequence:CCGGTGCGTCCTACAGATACCACAACTCGAGTTGTGGTATCTGTAGGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004049.3-381s21c1
Sequence:CCGGGCCAGAACACTATTCAACCAACTCGAGTTGGTTGAATAGTGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004049
VALIDATED
BCL2A1 MISSION shRNA shRNA Plasmid DNA
BCL2-related protein A1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004049.2-382s1c1
Sequence:CCGGGCCAGAACACTATTCAACCAACTCGAGTTGGTTGAATAGTGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004049.2-469s1c1
Sequence:CCGGGAAGGTATTCTCATCAAGAAACTCGAGTTTCTTGATGAGAATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004049.2-415s1c1
Sequence:CCGGGAGTTTGAAGACGGCATCATTCTCGAGAATGATGCCGTCTTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004049.2-238s1c1
Sequence:CCGGTGCGTCCTACAGATACCACAACTCGAGTTGTGGTATCTGTAGGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004049.2-547s1c1
Sequence:CCGGGTTGCGGAGTTCATAATGAATCTCGAGATTCATTATGAACTCCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004049.3-414s21c1
Sequence:CCGGGAGTTTGAAGACGGCATCATTCTCGAGAATGATGCCGTCTTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004049.3-546s21c1
Sequence:CCGGGTTGCGGAGTTCATAATGAATCTCGAGATTCATTATGAACTCCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004049.3-237s21c1
Sequence:CCGGTGCGTCCTACAGATACCACAACTCGAGTTGTGGTATCTGTAGGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004049.3-381s21c1
Sequence:CCGGGCCAGAACACTATTCAACCAACTCGAGTTGGTTGAATAGTGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004049
VALIDATED
BCL2A1 MISSION shRNA Lentiviral Transduction Particles
BCL2-related protein A1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004049.2-382s1c1
Sequence:CCGGGCCAGAACACTATTCAACCAACTCGAGTTGGTTGAATAGTGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004049.2-469s1c1
Sequence:CCGGGAAGGTATTCTCATCAAGAAACTCGAGTTTCTTGATGAGAATACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004049.2-415s1c1
Sequence:CCGGGAGTTTGAAGACGGCATCATTCTCGAGAATGATGCCGTCTTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004049.2-238s1c1
Sequence:CCGGTGCGTCCTACAGATACCACAACTCGAGTTGTGGTATCTGTAGGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004049.2-547s1c1
Sequence:CCGGGTTGCGGAGTTCATAATGAATCTCGAGATTCATTATGAACTCCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004049.3-414s21c1
Sequence:CCGGGAGTTTGAAGACGGCATCATTCTCGAGAATGATGCCGTCTTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004049.3-546s21c1
Sequence:CCGGGTTGCGGAGTTCATAATGAATCTCGAGATTCATTATGAACTCCGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004049.3-237s21c1
Sequence:CCGGTGCGTCCTACAGATACCACAACTCGAGTTGTGGTATCTGTAGGACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004049.3-381s21c1
Sequence:CCGGGCCAGAACACTATTCAACCAACTCGAGTTGGTTGAATAGTGTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks