EMAIL THIS PAGE TO A FRIEND

BCL2L10

BCL2-like 10 (apoptosis facilitator)

53 Gene Product Result for
Synonyms: BCL-B Boo Diva
UniProtKB ID: Q9HD36, Q3SX80, Q52LQ9, Q8TCS9
Gene ID:
Human(10017) Summary: The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains conserved BH4, BH1 and BH2 domains. This protein can interact with other members of BCL-2 protein family including BCL2, BCL2L1/BCL-X(L), and BAX. Overexpression of this gene has been shown to suppress cell apoptosis possibly through the prevention of cytochrome C release from the mitochondria, and thus activating caspase-3 activation. The mouse counterpart of this protein is found to interact with Apaf1 and forms a protein complex with Caspase 9, which suggests the involvement of this protein in APAF1 and CASPASE 9 related apoptotic pathway. [provided by RefSeq, Jul 2008]
Mouse(12049) Bcl2-like 10
Rat(114552) BCL2-like 10 (apoptosis facilitator)
domestic guinea pig(100718777) BCL2-like 10 (apoptosis facilitator)
naked mole-rat(101700948) BCL2-like 10 (apoptosis facilitator)
sheep(101106530) BCL2-like 10 (apoptosis facilitator)
Zebrafish(373113) BCL2-like 10 (apoptosis facilitator)
cow(523056) BCL2-like 10 (apoptosis facilitator)
domestic cat(101082064) BCL2-like 10 (apoptosis facilitator)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020396 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU002351 MISSION® esiRNA esiRNA targeting mouse Bcl2l10 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020396 Rosetta Predictions human pricing
NM_053733 Rosetta Predictions rat pricing
NM_013479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011828 predicted 214
2 SASI_Hs01_00011829 predicted 218
3 SASI_Hs01_00011830 predicted 520
4 SASI_Hs01_00011831 predicted 203
5 SASI_Hs01_00011832 predicted 287
6 SASI_Hs01_00011833 predicted 267
7 SASI_Hs01_00011834 predicted 204
8 SASI_Hs01_00011835 predicted 647
9 SASI_Hs02_00353378 predicted 380
10 SASI_Hs01_00011836 predicted 197
11 SASI_Hs01_00011837 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052780 predicted 609
2 SASI_Rn01_00052781 predicted 695
3 SASI_Rn01_00052782 predicted 850
4 SASI_Rn01_00052783 predicted 756
5 SASI_Rn01_00052784 predicted 553
6 SASI_Rn01_00052785 predicted 353
7 SASI_Rn01_00052786 predicted 791
8 SASI_Rn02_00266505 predicted 654
9 SASI_Rn01_00052788 predicted 361
10 SASI_Rn01_00052789 predicted 477
11 SASI_Rn01_00052787 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077131 predicted 508
2 SASI_Mm01_00077132 predicted 285
3 SASI_Mm01_00077133 predicted 601
4 SASI_Mm01_00077134 predicted 358
5 SASI_Mm01_00077135 predicted 494
6 SASI_Mm01_00077136 predicted 517
7 SASI_Mm01_00077137 predicted 747
8 SASI_Mm01_00077138 predicted 703
9 SASI_Mm01_00077139 predicted 450
10 SASI_Mm01_00077140 predicted 825
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013479
BCL2L10 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 10 (apoptosis facilitator)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013479.2-446s21c1
Sequence:CCGGATGAATCAAGGCCCTTACATGCTCGAGCATGTAAGGGCCTTGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013479.2-760s21c1
Sequence:CCGGGAACCCTCTAAGGAACAATTCCTCGAGGAATTGTTCCTTAGAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013479.1-365s1c1
Sequence:CCGGGCAGATAAGTTGCTCTCCAAACTCGAGTTTGGAGAGCAACTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013479.1-808s1c1
Sequence:CCGGTCCAGCCTAGAGACATTTCTACTCGAGTAGAAATGTCTCTAGGCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013479.1-521s1c1
Sequence:CCGGCTCATAGTGAACTTTCTGTATCTCGAGATACAGAAAGTTCACTATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013479.1-184s1c1
Sequence:CCGGGCTGCTGTCTGACTACATATTCTCGAGAATATGTAGTCAGACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013479.1-607s1c1
Sequence:CCGGCCGCTTCTTCAAGAATCCTTTCTCGAGAAAGGATTCTTGAAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013479
BCL2L10 MISSION shRNA shRNA Plasmid DNA
BCL2-like 10 (apoptosis facilitator)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013479.2-446s21c1
Sequence:CCGGATGAATCAAGGCCCTTACATGCTCGAGCATGTAAGGGCCTTGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013479.2-760s21c1
Sequence:CCGGGAACCCTCTAAGGAACAATTCCTCGAGGAATTGTTCCTTAGAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013479.1-365s1c1
Sequence:CCGGGCAGATAAGTTGCTCTCCAAACTCGAGTTTGGAGAGCAACTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013479.1-808s1c1
Sequence:CCGGTCCAGCCTAGAGACATTTCTACTCGAGTAGAAATGTCTCTAGGCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013479.1-521s1c1
Sequence:CCGGCTCATAGTGAACTTTCTGTATCTCGAGATACAGAAAGTTCACTATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013479.1-184s1c1
Sequence:CCGGGCTGCTGTCTGACTACATATTCTCGAGAATATGTAGTCAGACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013479.1-607s1c1
Sequence:CCGGCCGCTTCTTCAAGAATCCTTTCTCGAGAAAGGATTCTTGAAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013479
BCL2L10 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 10 (apoptosis facilitator)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013479.2-446s21c1
Sequence:CCGGATGAATCAAGGCCCTTACATGCTCGAGCATGTAAGGGCCTTGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425063    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013479.2-760s21c1
Sequence:CCGGGAACCCTCTAAGGAACAATTCCTCGAGGAATTGTTCCTTAGAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013479.1-365s1c1
Sequence:CCGGGCAGATAAGTTGCTCTCCAAACTCGAGTTTGGAGAGCAACTTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013479.1-808s1c1
Sequence:CCGGTCCAGCCTAGAGACATTTCTACTCGAGTAGAAATGTCTCTAGGCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013479.1-521s1c1
Sequence:CCGGCTCATAGTGAACTTTCTGTATCTCGAGATACAGAAAGTTCACTATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013479.1-184s1c1
Sequence:CCGGGCTGCTGTCTGACTACATATTCTCGAGAATATGTAGTCAGACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013479.1-607s1c1
Sequence:CCGGCCGCTTCTTCAAGAATCCTTTCTCGAGAAAGGATTCTTGAAGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020396
BCL2L10 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 10 (apoptosis facilitator)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020396.2-707s21c1
Sequence:CCGGCAACTAAATGACAGATGTGTGCTCGAGCACACATCTGTCATTTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020396.2-694s21c1
Sequence:CCGGGCCCAACTGTGACCAACTAAACTCGAGTTTAGTTGGTCACAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020396.2-648s21c1
Sequence:CCGGGGACACGATTATTATGAGTTTCTCGAGAAACTCATAATAATCGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020396.2-727s21c1
Sequence:CCGGGAGAACAAGAACTGAGGGAAACTCGAGTTTCCCTCAGTTCTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-619s1c1
Sequence:CCGGCTTGTTAACAACAGCCTTCATCTCGAGATGAAGGCTGTTGTTAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-349s1c1
Sequence:CCGGCGTGACCTTCGCAGGGACGCTCTCGAGAGCGTCCCTGCGAAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-637s1c1
Sequence:CCGGCATTTATCTCTGGACACGATTCTCGAGAATCGTGTCCAGAGATAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-218s1c1
Sequence:CCGGCGGCAGATTCACCGGTCCTTTCTCGAGAAAGGACCGGTGAATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-206s1c1
Sequence:CCGGGCCGCCAGGTTACGGCAGATTCTCGAGAATCTGCCGTAACCTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020396
BCL2L10 MISSION shRNA shRNA Plasmid DNA
BCL2-like 10 (apoptosis facilitator)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020396.2-707s21c1
Sequence:CCGGCAACTAAATGACAGATGTGTGCTCGAGCACACATCTGTCATTTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020396.2-694s21c1
Sequence:CCGGGCCCAACTGTGACCAACTAAACTCGAGTTTAGTTGGTCACAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020396.2-648s21c1
Sequence:CCGGGGACACGATTATTATGAGTTTCTCGAGAAACTCATAATAATCGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020396.2-727s21c1
Sequence:CCGGGAGAACAAGAACTGAGGGAAACTCGAGTTTCCCTCAGTTCTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-619s1c1
Sequence:CCGGCTTGTTAACAACAGCCTTCATCTCGAGATGAAGGCTGTTGTTAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-349s1c1
Sequence:CCGGCGTGACCTTCGCAGGGACGCTCTCGAGAGCGTCCCTGCGAAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-637s1c1
Sequence:CCGGCATTTATCTCTGGACACGATTCTCGAGAATCGTGTCCAGAGATAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-218s1c1
Sequence:CCGGCGGCAGATTCACCGGTCCTTTCTCGAGAAAGGACCGGTGAATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-206s1c1
Sequence:CCGGGCCGCCAGGTTACGGCAGATTCTCGAGAATCTGCCGTAACCTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020396
BCL2L10 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 10 (apoptosis facilitator)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020396.2-707s21c1
Sequence:CCGGCAACTAAATGACAGATGTGTGCTCGAGCACACATCTGTCATTTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020396.2-694s21c1
Sequence:CCGGGCCCAACTGTGACCAACTAAACTCGAGTTTAGTTGGTCACAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020396.2-648s21c1
Sequence:CCGGGGACACGATTATTATGAGTTTCTCGAGAAACTCATAATAATCGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020396.2-727s21c1
Sequence:CCGGGAGAACAAGAACTGAGGGAAACTCGAGTTTCCCTCAGTTCTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-619s1c1
Sequence:CCGGCTTGTTAACAACAGCCTTCATCTCGAGATGAAGGCTGTTGTTAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-349s1c1
Sequence:CCGGCGTGACCTTCGCAGGGACGCTCTCGAGAGCGTCCCTGCGAAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-637s1c1
Sequence:CCGGCATTTATCTCTGGACACGATTCTCGAGAATCGTGTCCAGAGATAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-218s1c1
Sequence:CCGGCGGCAGATTCACCGGTCCTTTCTCGAGAAAGGACCGGTGAATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020396.2-206s1c1
Sequence:CCGGGCCGCCAGGTTACGGCAGATTCTCGAGAATCTGCCGTAACCTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks