EMAIL THIS PAGE TO A FRIEND

BCL2L12

BCL2-like 12 (proline rich)

72 Gene Product Result for
UniProtKB ID: Q9HB09, Q3SY11, Q3SY13, Q96I96, Q9HB08
Gene ID:
Human(83596) Summary: The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein contains a Bcl-2 homology domain 2 (BH2). The function of this gene has not yet been determined. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(75736) BCL2-like 12 (proline rich)
Rat(361567) BCL2-like 12 (proline rich)
domestic guinea pig(100723155) BCL2-like 12 (proline rich)
naked mole-rat(101723096) BCL2-like 12 (proline rich)
sheep(101112670) BCL2-like 12 (proline rich)
domestic cat(101080498) BCL2-like 12 (proline rich)
cow(533338) BCL2-like 12 (proline rich)
dog(100688537) BCL2-like 12 (proline rich)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040668 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052842 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU001551 MISSION® esiRNA esiRNA targeting mouse Bcl2l12 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040668 Rosetta Predictions human pricing
NM_138639 Rosetta Predictions human pricing
NM_001108480 Rosetta Predictions rat pricing
NM_029410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131467 predicted 1387
2 SASI_Hs01_00131468 predicted 1566
3 SASI_Hs01_00131469 predicted 737
4 SASI_Hs01_00131470 predicted 776
5 SASI_Hs01_00131471 predicted 741
6 SASI_Hs01_00131472 predicted 1389
7 SASI_Hs01_00131473 predicted 1329
8 SASI_Hs01_00131474 predicted 1510
9 SASI_Hs01_00131475 predicted 1373
10 SASI_Hs01_00131476 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241246 predicted 1395
2 SASI_Hs01_00241247 predicted 1566
3 SASI_Hs01_00241248 predicted 738
4 SASI_Hs01_00241249 predicted 775
5 SASI_Hs01_00241250 predicted 742
6 SASI_Hs01_00241251 predicted 1398
7 SASI_Hs01_00241252 predicted 1334
8 SASI_Hs01_00241253 predicted 1514
9 SASI_Hs01_00241254 predicted 1379
10 SASI_Hs01_00241255 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239059 predicted 677
2 SASI_Rn02_00239060 predicted 416
3 SASI_Rn02_00239061 predicted 291
4 SASI_Rn02_00239062 predicted 676
5 SASI_Rn02_00239063 predicted 857
6 SASI_Rn02_00239064 predicted 406
7 SASI_Rn02_00239065 predicted 326
8 SASI_Rn02_00239066 predicted 749
9 SASI_Rn02_00239067 predicted 564
10 SASI_Rn02_00239068 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146001 predicted 529
2 SASI_Mm01_00146002 predicted 269
3 SASI_Mm01_00146003 predicted 525
4 SASI_Mm01_00146004 predicted 517
5 SASI_Mm01_00146005 predicted 490
6 SASI_Mm01_00146006 predicted 602
7 SASI_Mm01_00146007 predicted 601
8 SASI_Mm01_00146008 predicted 491
9 SASI_Mm01_00146009 predicted 242
10 SASI_Mm01_00146010 predicted 609
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040668
BCL2L12 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 12 (proline rich)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040668.1-1672s21c1
Sequence:CCGGGCCATTGGACTGAGCTCTTTCCTCGAGGAAAGAGCTCAGTCCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040668.1-1703s21c1
Sequence:CCGGCTACAAGATGACACCTCATGTCTCGAGACATGAGGTGTCATCTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040668.1-1073s21c1
Sequence:CCGGAGCCGCCTTCGAAGATGTCTTCTCGAGAAGACATCTTCGAAGGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040668.1-1649s21c1
Sequence:CCGGGTTTCACCCGTGGACTTGAACCTCGAGGTTCAAGTCCACGGGTGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040668.1-1235s21c1
Sequence:CCGGGTCCAAGAGCAGCTGAAATCTCTCGAGAGATTTCAGCTGCTCTTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040668
BCL2L12 MISSION shRNA shRNA Plasmid DNA
BCL2-like 12 (proline rich)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040668.1-1672s21c1
Sequence:CCGGGCCATTGGACTGAGCTCTTTCCTCGAGGAAAGAGCTCAGTCCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040668.1-1703s21c1
Sequence:CCGGCTACAAGATGACACCTCATGTCTCGAGACATGAGGTGTCATCTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040668.1-1073s21c1
Sequence:CCGGAGCCGCCTTCGAAGATGTCTTCTCGAGAAGACATCTTCGAAGGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040668.1-1649s21c1
Sequence:CCGGGTTTCACCCGTGGACTTGAACCTCGAGGTTCAAGTCCACGGGTGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040668.1-1235s21c1
Sequence:CCGGGTCCAAGAGCAGCTGAAATCTCTCGAGAGATTTCAGCTGCTCTTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040668
BCL2L12 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 12 (proline rich)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040668.1-1672s21c1
Sequence:CCGGGCCATTGGACTGAGCTCTTTCCTCGAGGAAAGAGCTCAGTCCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040668.1-1703s21c1
Sequence:CCGGCTACAAGATGACACCTCATGTCTCGAGACATGAGGTGTCATCTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040668.1-1073s21c1
Sequence:CCGGAGCCGCCTTCGAAGATGTCTTCTCGAGAAGACATCTTCGAAGGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040668.1-1649s21c1
Sequence:CCGGGTTTCACCCGTGGACTTGAACCTCGAGGTTCAAGTCCACGGGTGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040668.1-1235s21c1
Sequence:CCGGGTCCAAGAGCAGCTGAAATCTCTCGAGAGATTTCAGCTGCTCTTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029410
BCL2L12 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 12 (proline rich)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029410.2-170s21c1
Sequence:CCGGGGTTCTGACGGCCTTCCTTAACTCGAGTTAAGGAAGGCCGTCAGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029410.2-726s21c1
Sequence:CCGGCTGGCACTAGCCATGGAATTGCTCGAGCAATTCCATGGCTAGTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029410.2-242s21c1
Sequence:CCGGCCAAGAGGAGACAACAGATTTCTCGAGAAATCTGTTGTCTCCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029410.2-880s21c1
Sequence:CCGGTGCCCTTGGACTGAACGTTTCCTCGAGGAAACGTTCAGTCCAAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029410.2-908s21c1
Sequence:CCGGCCAGCATAGATGACTGAAATACTCGAGTATTTCAGTCATCTATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029410.1-861s1c1
Sequence:CCGGCTCACCTGTGGACTTGAACTTCTCGAGAAGTTCAAGTCCACAGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029410.1-532s1c1
Sequence:CCGGGAGGCAGAAGTCATCAACCAACTCGAGTTGGTTGATGACTTCTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029410.1-909s1c1
Sequence:CCGGCCAGCATAGATGACTGAAATACTCGAGTATTTCAGTCATCTATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029410
BCL2L12 MISSION shRNA shRNA Plasmid DNA
BCL2-like 12 (proline rich)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029410.2-170s21c1
Sequence:CCGGGGTTCTGACGGCCTTCCTTAACTCGAGTTAAGGAAGGCCGTCAGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029410.2-726s21c1
Sequence:CCGGCTGGCACTAGCCATGGAATTGCTCGAGCAATTCCATGGCTAGTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029410.2-242s21c1
Sequence:CCGGCCAAGAGGAGACAACAGATTTCTCGAGAAATCTGTTGTCTCCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029410.2-880s21c1
Sequence:CCGGTGCCCTTGGACTGAACGTTTCCTCGAGGAAACGTTCAGTCCAAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029410.2-908s21c1
Sequence:CCGGCCAGCATAGATGACTGAAATACTCGAGTATTTCAGTCATCTATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029410.1-861s1c1
Sequence:CCGGCTCACCTGTGGACTTGAACTTCTCGAGAAGTTCAAGTCCACAGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029410.1-532s1c1
Sequence:CCGGGAGGCAGAAGTCATCAACCAACTCGAGTTGGTTGATGACTTCTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029410.1-909s1c1
Sequence:CCGGCCAGCATAGATGACTGAAATACTCGAGTATTTCAGTCATCTATGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029410
BCL2L12 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 12 (proline rich)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029410.2-170s21c1
Sequence:CCGGGGTTCTGACGGCCTTCCTTAACTCGAGTTAAGGAAGGCCGTCAGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029410.2-726s21c1
Sequence:CCGGCTGGCACTAGCCATGGAATTGCTCGAGCAATTCCATGGCTAGTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029410.2-242s21c1
Sequence:CCGGCCAAGAGGAGACAACAGATTTCTCGAGAAATCTGTTGTCTCCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029410.2-880s21c1
Sequence:CCGGTGCCCTTGGACTGAACGTTTCCTCGAGGAAACGTTCAGTCCAAGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029410.2-908s21c1
Sequence:CCGGCCAGCATAGATGACTGAAATACTCGAGTATTTCAGTCATCTATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029410.1-861s1c1
Sequence:CCGGCTCACCTGTGGACTTGAACTTCTCGAGAAGTTCAAGTCCACAGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029410.1-532s1c1
Sequence:CCGGGAGGCAGAAGTCATCAACCAACTCGAGTTGGTTGATGACTTCTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029410.1-909s1c1
Sequence:CCGGCCAGCATAGATGACTGAAATACTCGAGTATTTCAGTCATCTATGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052842
BCL2L12 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 12 (proline rich)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-836s1c1
Sequence:CCGGCGCGGGAAAGTTGAACTAATACTCGAGTATTAGTTCAACTTTCCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-755s1c1
Sequence:CCGGCGTCACATGCAAATTGAGCGTCTCGAGACGCTCAATTTGCATGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-1192s1c1
Sequence:CCGGAGGAGGAGGCAGAAGTCATTACTCGAGTAATGACTTCTGCCTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-837s1c1
Sequence:CCGGGCGGGAAAGTTGAACTAATAACTCGAGTTATTAGTTCAACTTTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-1043s1c1
Sequence:CCGGCCCAGCTACTCCAGACTTCTACTCGAGTAGAAGTCTGGAGTAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052842
BCL2L12 MISSION shRNA shRNA Plasmid DNA
BCL2-like 12 (proline rich)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-836s1c1
Sequence:CCGGCGCGGGAAAGTTGAACTAATACTCGAGTATTAGTTCAACTTTCCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-755s1c1
Sequence:CCGGCGTCACATGCAAATTGAGCGTCTCGAGACGCTCAATTTGCATGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-1192s1c1
Sequence:CCGGAGGAGGAGGCAGAAGTCATTACTCGAGTAATGACTTCTGCCTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-837s1c1
Sequence:CCGGGCGGGAAAGTTGAACTAATAACTCGAGTTATTAGTTCAACTTTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-1043s1c1
Sequence:CCGGCCCAGCTACTCCAGACTTCTACTCGAGTAGAAGTCTGGAGTAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052842
BCL2L12 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 12 (proline rich)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-836s1c1
Sequence:CCGGCGCGGGAAAGTTGAACTAATACTCGAGTATTAGTTCAACTTTCCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-755s1c1
Sequence:CCGGCGTCACATGCAAATTGAGCGTCTCGAGACGCTCAATTTGCATGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-1192s1c1
Sequence:CCGGAGGAGGAGGCAGAAGTCATTACTCGAGTAATGACTTCTGCCTCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-837s1c1
Sequence:CCGGGCGGGAAAGTTGAACTAATAACTCGAGTTATTAGTTCAACTTTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052842.2-1043s1c1
Sequence:CCGGCCCAGCTACTCCAGACTTCTACTCGAGTAGAAGTCTGGAGTAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)