EMAIL THIS PAGE TO A FRIEND

BCL2L13

BCL2-like 13 (apoptosis facilitator)

71 Gene Product Result for
Synonyms: BCL-RAMBO Bcl2-L-13 MIL1
Gene ID:
Human(23786) Summary: This gene encodes a mitochondrially-localized protein with conserved B-cell lymphoma 2 homology motifs. Overexpression of the encoded protein results in apoptosis. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(94044) BCL2-like 13 (apoptosis facilitator)
Rat(312682) BCL2-like 13 (apoptosis facilitator)
Zebrafish(559355) BCL2-like 13 (apoptosis facilitator)
cow(617809) BCL2-like 13 (apoptosis facilitator)
Horse(100055032) BCL2-like 13 (apoptosis facilitator)
domestic cat(768270) BCL2-like 13 (apoptosis facilitator)
dog(477742) BCL2-like 13 (apoptosis facilitator)
chicken(418163) BCL2-like 13 (apoptosis facilitator)
sheep(101117580) BCL2-like 13 (apoptosis facilitator)
naked mole-rat(101711722) BCL2-like 13 (apoptosis facilitator)
domestic guinea pig(100725962) BCL2-like 13 (apoptosis facilitator)
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015367 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015367 Rosetta Predictions human pricing
NM_001107885 Rosetta Predictions rat pricing
NM_153516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058721 predicted 551
2 SASI_Hs01_00058722 predicted 1703
3 SASI_Hs02_00347705 predicted 1132
4 SASI_Hs01_00058724 predicted 1299
5 SASI_Hs02_00347706 predicted 240
6 SASI_Hs01_00058725 predicted 771
7 SASI_Hs01_00058727 predicted 463
8 SASI_Hs01_00058728 predicted 990
9 SASI_Hs02_00347707 predicted 353
10 SASI_Hs01_00058729 predicted 342
11 SASI_Hs01_00058723 predicted 577
12 SASI_Hs01_00058726 predicted 1342
13 SASI_Hs01_00058730 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233235 predicted 425
2 SASI_Rn02_00233236 predicted 744
3 SASI_Rn02_00233237 predicted 215
4 SASI_Rn02_00233238 predicted 686
5 SASI_Rn02_00233239 predicted 321
6 SASI_Rn02_00233240 predicted 452
7 SASI_Rn02_00233241 predicted 447
8 SASI_Rn02_00233242 predicted 212
9 SASI_Rn02_00233243 predicted 571
10 SASI_Rn02_00233244 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151019 predicted 1177
2 SASI_Mm01_00151020 predicted 1533
3 SASI_Mm01_00151021 predicted 733
4 SASI_Mm02_00343276 predicted 1011
5 SASI_Mm01_00151022 predicted 885
6 SASI_Mm01_00151023 predicted 1526
7 SASI_Mm01_00151024 predicted 346
8 SASI_Mm01_00151026 predicted 208
9 SASI_Mm01_00151027 predicted 556
10 SASI_Mm01_00151028 predicted 1502
11 SASI_Mm01_00151025 predicted 1463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153516
VALIDATED
BCL2L13 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 13 (apoptosis facilitator)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153516.1-2242s1c1
Sequence:CCGGGCAAAGAGATTATCCCAAGTTCTCGAGAACTTGGGATAATCTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153516.1-2147s1c1
Sequence:CCGGGCTCCATCTTTCAAAGATGATCTCGAGATCATCTTTGAAAGATGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153516.2-422s21c1
Sequence:CCGGGTCACACCTCGCCTGTGTTTACTCGAGTAAACACAGGCGAGGTGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153516.2-5965s21c1
Sequence:CCGGCCCTTTGCGGCACGGAATAATCTCGAGATTATTCCGTGCCGCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153516.2-564s21c1
Sequence:CCGGATATGAGGCATATCGTGAATGCTCGAGCATTCACGATATGCCTCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153516.2-823s1c1
Sequence:CCGGGAAGATAGCAATGACATTTATCTCGAGATAAATGTCATTGCTATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153516.2-734s21c1
Sequence:CCGGACGCCGCAGAGTTCATCATTCCTCGAGGAATGATGAACTCTGCGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153516.2-823s21c1
Sequence:CCGGGAAGATAGCAATGACATTTATCTCGAGATAAATGTCATTGCTATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153516
VALIDATED
BCL2L13 MISSION shRNA shRNA Plasmid DNA
BCL2-like 13 (apoptosis facilitator)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153516.1-2242s1c1
Sequence:CCGGGCAAAGAGATTATCCCAAGTTCTCGAGAACTTGGGATAATCTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153516.1-2147s1c1
Sequence:CCGGGCTCCATCTTTCAAAGATGATCTCGAGATCATCTTTGAAAGATGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153516.2-422s21c1
Sequence:CCGGGTCACACCTCGCCTGTGTTTACTCGAGTAAACACAGGCGAGGTGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153516.2-5965s21c1
Sequence:CCGGCCCTTTGCGGCACGGAATAATCTCGAGATTATTCCGTGCCGCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153516.2-564s21c1
Sequence:CCGGATATGAGGCATATCGTGAATGCTCGAGCATTCACGATATGCCTCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153516.2-823s1c1
Sequence:CCGGGAAGATAGCAATGACATTTATCTCGAGATAAATGTCATTGCTATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153516.2-734s21c1
Sequence:CCGGACGCCGCAGAGTTCATCATTCCTCGAGGAATGATGAACTCTGCGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153516.2-823s21c1
Sequence:CCGGGAAGATAGCAATGACATTTATCTCGAGATAAATGTCATTGCTATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153516
VALIDATED
BCL2L13 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 13 (apoptosis facilitator)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153516.1-2242s1c1
Sequence:CCGGGCAAAGAGATTATCCCAAGTTCTCGAGAACTTGGGATAATCTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193470    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153516.1-2147s1c1
Sequence:CCGGGCTCCATCTTTCAAAGATGATCTCGAGATCATCTTTGAAAGATGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153516.2-422s21c1
Sequence:CCGGGTCACACCTCGCCTGTGTTTACTCGAGTAAACACAGGCGAGGTGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153516.2-5965s21c1
Sequence:CCGGCCCTTTGCGGCACGGAATAATCTCGAGATTATTCCGTGCCGCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153516.2-564s21c1
Sequence:CCGGATATGAGGCATATCGTGAATGCTCGAGCATTCACGATATGCCTCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153516.2-823s1c1
Sequence:CCGGGAAGATAGCAATGACATTTATCTCGAGATAAATGTCATTGCTATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153516.2-734s21c1
Sequence:CCGGACGCCGCAGAGTTCATCATTCCTCGAGGAATGATGAACTCTGCGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153516.2-823s21c1
Sequence:CCGGGAAGATAGCAATGACATTTATCTCGAGATAAATGTCATTGCTATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015367
VALIDATED
BCL2L13 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 13 (apoptosis facilitator)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015367.2-606s1c1
Sequence:CCGGCCAGTGACATATCAGGCATTTCTCGAGAAATGCCTGATATGTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015367.2-1109s1c1
Sequence:CCGGGAGTGAGAACAACTCCTCTAACTCGAGTTAGAGGAGTTGTTCTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015367.2-570s1c1
Sequence:CCGGCCTCTCCATAAAGCATTGCAACTCGAGTTGCAATGCTTTATGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015367.2-1442s1c1
Sequence:CCGGGCTGAGTGAGAAGGAGATAAACTCGAGTTTATCTCCTTCTCACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015367.2-784s21c1
Sequence:CCGGATTCGGCAGAGTACATCATTCCTCGAGGAATGATGTACTCTGCCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015367.2-1578s21c1
Sequence:CCGGCTGTCTGAGGGCAAGTCTATACTCGAGTATAGACTTGCCCTCAGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015367.2-2994s21c1
Sequence:GTACCGGTAGTTGAGCATCGGCATAATTCTCGAGAATTATGCCGATGCTCAACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015367.2-1244s21c1
Sequence:CCGGAGCTCCCTTGCTTCCACATATCTCGAGATATGTGGAAGCAAGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015367.2-658s21c1
Sequence:CCGGCCAGCGGCTGGAATAAGATTTCTCGAGAAATCTTATTCCAGCCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015367
VALIDATED
BCL2L13 MISSION shRNA shRNA Plasmid DNA
BCL2-like 13 (apoptosis facilitator)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015367.2-606s1c1
Sequence:CCGGCCAGTGACATATCAGGCATTTCTCGAGAAATGCCTGATATGTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015367.2-1109s1c1
Sequence:CCGGGAGTGAGAACAACTCCTCTAACTCGAGTTAGAGGAGTTGTTCTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015367.2-570s1c1
Sequence:CCGGCCTCTCCATAAAGCATTGCAACTCGAGTTGCAATGCTTTATGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015367.2-1442s1c1
Sequence:CCGGGCTGAGTGAGAAGGAGATAAACTCGAGTTTATCTCCTTCTCACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015367.2-784s21c1
Sequence:CCGGATTCGGCAGAGTACATCATTCCTCGAGGAATGATGTACTCTGCCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015367.2-1578s21c1
Sequence:CCGGCTGTCTGAGGGCAAGTCTATACTCGAGTATAGACTTGCCCTCAGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015367.2-2994s21c1
Sequence:GTACCGGTAGTTGAGCATCGGCATAATTCTCGAGAATTATGCCGATGCTCAACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015367.2-1244s21c1
Sequence:CCGGAGCTCCCTTGCTTCCACATATCTCGAGATATGTGGAAGCAAGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015367.2-658s21c1
Sequence:CCGGCCAGCGGCTGGAATAAGATTTCTCGAGAAATCTTATTCCAGCCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015367
VALIDATED
BCL2L13 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 13 (apoptosis facilitator)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015367.2-606s1c1
Sequence:CCGGCCAGTGACATATCAGGCATTTCTCGAGAAATGCCTGATATGTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015367.2-1109s1c1
Sequence:CCGGGAGTGAGAACAACTCCTCTAACTCGAGTTAGAGGAGTTGTTCTCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015367.2-570s1c1
Sequence:CCGGCCTCTCCATAAAGCATTGCAACTCGAGTTGCAATGCTTTATGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015367.2-1442s1c1
Sequence:CCGGGCTGAGTGAGAAGGAGATAAACTCGAGTTTATCTCCTTCTCACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015367.2-784s21c1
Sequence:CCGGATTCGGCAGAGTACATCATTCCTCGAGGAATGATGTACTCTGCCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015367.2-1578s21c1
Sequence:CCGGCTGTCTGAGGGCAAGTCTATACTCGAGTATAGACTTGCCCTCAGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015367.2-2994s21c1
Sequence:GTACCGGTAGTTGAGCATCGGCATAATTCTCGAGAATTATGCCGATGCTCAACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015367.2-1244s21c1
Sequence:CCGGAGCTCCCTTGCTTCCACATATCTCGAGATATGTGGAAGCAAGGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015367.2-658s21c1
Sequence:CCGGCCAGCGGCTGGAATAAGATTTCTCGAGAAATCTTATTCCAGCCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)