EMAIL THIS PAGE TO A FRIEND

BCL2L14

BCL2-like 14 (apoptosis facilitator)

145 Gene Product Result for
Synonyms: BCLG
UniProtKB ID: Q9BZR8, A8KAD0, Q96QR5, Q9BZR7
Gene ID:
Human(79370) Summary: The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. Overexpression of this gene has been shown to induce apoptosis in cells. Three alternatively spliced transcript variants encoding two distinct isoforms have been reported for this gene. [provided by RefSeq, May 2009]
Mouse(66813) BCL2-like 14 (apoptosis facilitator)
Rat(500348) Bcl2-like 14 (apoptosis facilitator)
domestic guinea pig(100727775) BCL2-like 14 (apoptosis facilitator)
naked mole-rat(101704323) BCL2-like 14 (apoptosis facilitator)
sheep(101113402) BCL2-like 14 (apoptosis facilitator)
chicken(419096) BCL2-like 14 (apoptosis facilitator)
dog(477693) BCL2-like 14 (apoptosis facilitator)
domestic cat(101091028) BCL2-like 14 (apoptosis facilitator)
cow(508365) BCL2-like 14 (apoptosis facilitator)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030766 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030766 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030766 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030766 Rosetta Predictions human pricing
NM_138722 Rosetta Predictions human pricing
NM_138723 Rosetta Predictions human pricing
NM_138724 Rosetta Predictions human pricing
NM_001024338 Rosetta Predictions rat pricing
NM_025778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037074 predicted 571
2 SASI_Hs01_00037075 predicted 433
3 SASI_Hs01_00037076 predicted 440
4 SASI_Hs01_00037077 predicted 440
5 SASI_Hs01_00037079 predicted 515
6 SASI_Hs01_00037080 predicted 466
7 SASI_Hs01_00037081 predicted 430
8 SASI_Hs02_00358300 predicted 395
9 SASI_Hs01_00037082 predicted 603
10 SASI_Hs01_00037083 predicted 396
11 SASI_Hs01_00037078 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066838 predicted 577
2 SASI_Hs01_00066839 predicted 436
3 SASI_Hs01_00066840 predicted 440
4 SASI_Hs01_00066841 predicted 437
5 SASI_Hs01_00066843 predicted 519
6 SASI_Hs01_00066844 predicted 473
7 SASI_Hs01_00066845 predicted 425
8 SASI_Hs02_00363832 predicted 397
9 SASI_Hs01_00066846 predicted 608
10 SASI_Hs01_00066847 predicted 392
11 SASI_Hs01_00066842 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012311 predicted 577
2 SASI_Hs01_00012312 predicted 447
3 SASI_Hs01_00012313 predicted 438
4 SASI_Hs01_00012314 predicted 442
5 SASI_Hs01_00012316 predicted 521
6 SASI_Hs01_00012317 predicted 478
7 SASI_Hs01_00012318 predicted 439
8 SASI_Hs02_00363833 predicted 399
9 SASI_Hs01_00012319 predicted 606
10 SASI_Hs01_00012320 predicted 403
11 SASI_Hs01_00012315 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182840 predicted 382
2 SASI_Hs01_00182841 predicted 247
3 SASI_Hs01_00182842 predicted 249
4 SASI_Hs01_00182843 predicted 251
5 SASI_Hs01_00182845 predicted 331
6 SASI_Hs01_00182846 predicted 278
7 SASI_Hs01_00182847 predicted 236
8 SASI_Hs02_00363834 predicted 206
9 SASI_Hs01_00182848 predicted 419
10 SASI_Hs01_00182849 predicted 206
11 SASI_Hs01_00182844 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087888 predicted 300
2 SASI_Rn01_00087889 predicted 434
3 SASI_Rn01_00087891 predicted 831
4 SASI_Rn01_00087892 predicted 844
5 SASI_Rn02_00202566 predicted 819
6 SASI_Rn01_00087893 predicted 775
7 SASI_Rn01_00087894 predicted 475
8 SASI_Rn01_00087895 predicted 649
9 SASI_Rn01_00087896 predicted 456
10 SASI_Rn01_00087897 predicted 421
11 SASI_Rn01_00087890 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185662 predicted 808
2 SASI_Mm01_00185663 predicted 864
3 SASI_Mm01_00185664 predicted 719
4 SASI_Mm01_00185666 predicted 298
5 SASI_Mm01_00185667 predicted 871
6 SASI_Mm02_00328996 predicted 832
7 SASI_Mm01_00185668 predicted 426
8 SASI_Mm01_00185669 predicted 976
9 SASI_Mm01_00185670 predicted 694
10 SASI_Mm01_00185671 predicted 293
11 SASI_Mm01_00185665 predicted 1309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025778
BCL2L14 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 14 (apoptosis facilitator)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025778.3-915s21c1
Sequence:CCGGCAGTTGGGAAGAGAGATAAAGCTCGAGCTTTATCTCTCTTCCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025778.3-1218s1c1
Sequence:CCGGCATGAAGAAGTAGACTGAAATCTCGAGATTTCAGTCTACTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025778.3-1105s21c1
Sequence:CCGGTCGACAACCACCCAATGAATACTCGAGTATTCATTGGGTGGTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025778.3-1577s21c1
Sequence:CCGGCATGGAGGTGAAACGATAAATCTCGAGATTTATCGTTTCACCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025778.3-441s21c1
Sequence:CCGGTCCTGGACACAGGTATCATTGCTCGAGCAATGATACCTGTGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025778.3-699s21c1
Sequence:CCGGGATTCCAAAGTGGCTTGTATTCTCGAGAATACAAGCCACTTTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025778.1-705s1c1
Sequence:CCGGCAAAGTGGCTTGTATTGCCAACTCGAGTTGGCAATACAAGCCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025778.1-811s1c1
Sequence:CCGGGAGATTCTGTACTTCAGGTTTCTCGAGAAACCTGAAGTACAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178188    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025778.1-1703s1c1
Sequence:CCGGCCTATTCATGTCAGAGAGAAACTCGAGTTTCTCTCTGACATGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025778
BCL2L14 MISSION shRNA shRNA Plasmid DNA
BCL2-like 14 (apoptosis facilitator)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025778.3-915s21c1
Sequence:CCGGCAGTTGGGAAGAGAGATAAAGCTCGAGCTTTATCTCTCTTCCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025778.3-1218s1c1
Sequence:CCGGCATGAAGAAGTAGACTGAAATCTCGAGATTTCAGTCTACTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025778.3-1105s21c1
Sequence:CCGGTCGACAACCACCCAATGAATACTCGAGTATTCATTGGGTGGTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025778.3-1577s21c1
Sequence:CCGGCATGGAGGTGAAACGATAAATCTCGAGATTTATCGTTTCACCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025778.3-441s21c1
Sequence:CCGGTCCTGGACACAGGTATCATTGCTCGAGCAATGATACCTGTGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025778.3-699s21c1
Sequence:CCGGGATTCCAAAGTGGCTTGTATTCTCGAGAATACAAGCCACTTTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025778.1-705s1c1
Sequence:CCGGCAAAGTGGCTTGTATTGCCAACTCGAGTTGGCAATACAAGCCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025778.1-811s1c1
Sequence:CCGGGAGATTCTGTACTTCAGGTTTCTCGAGAAACCTGAAGTACAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178188    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025778.1-1703s1c1
Sequence:CCGGCCTATTCATGTCAGAGAGAAACTCGAGTTTCTCTCTGACATGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025778
BCL2L14 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 14 (apoptosis facilitator)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025778.3-915s21c1
Sequence:CCGGCAGTTGGGAAGAGAGATAAAGCTCGAGCTTTATCTCTCTTCCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025778.3-1218s1c1
Sequence:CCGGCATGAAGAAGTAGACTGAAATCTCGAGATTTCAGTCTACTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025778.3-1105s21c1
Sequence:CCGGTCGACAACCACCCAATGAATACTCGAGTATTCATTGGGTGGTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025778.3-1577s21c1
Sequence:CCGGCATGGAGGTGAAACGATAAATCTCGAGATTTATCGTTTCACCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025778.3-441s21c1
Sequence:CCGGTCCTGGACACAGGTATCATTGCTCGAGCAATGATACCTGTGTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025778.3-699s21c1
Sequence:CCGGGATTCCAAAGTGGCTTGTATTCTCGAGAATACAAGCCACTTTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025778.1-705s1c1
Sequence:CCGGCAAAGTGGCTTGTATTGCCAACTCGAGTTGGCAATACAAGCCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025778.1-811s1c1
Sequence:CCGGGAGATTCTGTACTTCAGGTTTCTCGAGAAACCTGAAGTACAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178188    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025778.1-1703s1c1
Sequence:CCGGCCTATTCATGTCAGAGAGAAACTCGAGTTTCTCTCTGACATGAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030766
BCL2L14 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 14 (apoptosis facilitator)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-233s1c1
Sequence:CCGGCCCTAGATGATGATGACCTAACTCGAGTTAGGTCATCATCATCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-442s1c1
Sequence:CCGGGCCATAAACCTTGGCAAGAAACTCGAGTTTCTTGCCAAGGTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-277s1c1
Sequence:CCGGGCCTACTACACCAGACATCATCTCGAGATGATGTCTGGTGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-838s1c1
Sequence:CCGGCTGCTGAAATATTCAGGAGATCTCGAGATCTCCTGAATATTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-333s1c1
Sequence:CCGGGCTGCTGAGAACAAGAAGTTTCTCGAGAAACTTCTTGTTCTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030766
BCL2L14 MISSION shRNA shRNA Plasmid DNA
BCL2-like 14 (apoptosis facilitator)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-233s1c1
Sequence:CCGGCCCTAGATGATGATGACCTAACTCGAGTTAGGTCATCATCATCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-442s1c1
Sequence:CCGGGCCATAAACCTTGGCAAGAAACTCGAGTTTCTTGCCAAGGTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-277s1c1
Sequence:CCGGGCCTACTACACCAGACATCATCTCGAGATGATGTCTGGTGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-838s1c1
Sequence:CCGGCTGCTGAAATATTCAGGAGATCTCGAGATCTCCTGAATATTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-333s1c1
Sequence:CCGGGCTGCTGAGAACAAGAAGTTTCTCGAGAAACTTCTTGTTCTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030766
BCL2L14 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 14 (apoptosis facilitator)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-233s1c1
Sequence:CCGGCCCTAGATGATGATGACCTAACTCGAGTTAGGTCATCATCATCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-442s1c1
Sequence:CCGGGCCATAAACCTTGGCAAGAAACTCGAGTTTCTTGCCAAGGTTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-277s1c1
Sequence:CCGGGCCTACTACACCAGACATCATCTCGAGATGATGTCTGGTGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-838s1c1
Sequence:CCGGCTGCTGAAATATTCAGGAGATCTCGAGATCTCCTGAATATTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030766.1-333s1c1
Sequence:CCGGGCTGCTGAGAACAAGAAGTTTCTCGAGAAACTTCTTGTTCTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks