EMAIL THIS PAGE TO A FRIEND

BCL2L15

BCL2-like 15

229 Gene Product Result for
Synonyms: Bfk C1orf178
UniProtKB ID: Q5TBC7, A0PJY6, A8K074, I6LA82
Gene ID:
Mouse(229672) BCLl2-like 15
Rat(295337) BCL2-like 15
chicken(772088) BCL2-like 15
dog(606767) BCL2-like 15
cow(509786) BCL2-like 15
sheep(101120453) BCL2-like 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010922 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_149357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_149357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_149357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001142959 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001142959 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001142959 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010922 Rosetta Predictions human pricing
NM_001029944 Rosetta Predictions human pricing
NM_001029945 Rosetta Predictions human pricing
NM_001029946 Rosetta Predictions human pricing
NM_001106459 Rosetta Predictions rat pricing
XR_002337 Rosetta Predictions mouse pricing
XR_005162 Rosetta Predictions mouse pricing
XR_035396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305909 predicted 478
2 SASI_Hs02_00305910 predicted 587
3 SASI_Hs02_00305911 predicted 416
4 SASI_Hs01_00148566 predicted 504
5 SASI_Hs01_00148569 predicted 472
6 SASI_Hs01_00148571 predicted 513
7 SASI_Hs01_00148572 predicted 456
8 SASI_Hs02_00305912 predicted 615
9 SASI_Hs02_00305913 predicted 594
10 SASI_Hs01_00148573 predicted 293
11 SASI_Hs01_00148565 predicted 362
12 SASI_Hs01_00148567 predicted 375
13 SASI_Hs01_00148568 predicted 391
14 SASI_Hs01_00148570 predicted 279
15 SASI_Hs01_00148574 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152663 predicted 29
2 SASI_Hs01_00152664 predicted 218
3 SASI_Hs01_00152665 predicted 170
4 SASI_Hs01_00152666 predicted 199
5 SASI_Hs01_00152667 predicted 25
6 SASI_Hs01_00152668 predicted 194
7 SASI_Hs01_00152669 predicted 100
8 SASI_Hs01_00152670 predicted 20
9 SASI_Hs01_00152671 predicted 126
10 SASI_Hs01_00152672 predicted 37
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037629 predicted 38
2 SASI_Hs01_00037630 predicted 30
3 SASI_Hs01_00037631 predicted 100
4 SASI_Hs01_00037632 predicted 123
5 SASI_Hs01_00037633 predicted 126
6 SASI_Hs01_00037634 predicted 29
7 SASI_Hs01_00037635 predicted 168
8 SASI_Hs01_00037636 predicted 133
9 SASI_Hs01_00037637 predicted 35
10 SASI_Hs01_00037638 predicted 109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032669 predicted 88
2 SASI_Hs01_00032670 predicted 32
3 SASI_Hs01_00032671 predicted 140
4 SASI_Hs01_00032672 predicted 30
5 SASI_Hs01_00032673 predicted 86
6 SASI_Hs01_00032674 predicted 89
7 SASI_Hs01_00032675 predicted 92
8 SASI_Hs01_00032676 predicted 138
9 SASI_Hs01_00032677 predicted 28
10 SASI_Hs01_00032678 predicted 38
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219168 predicted 358
2 SASI_Rn02_00219169 predicted 430
3 SASI_Rn02_00219170 predicted 377
4 SASI_Rn02_00219171 predicted 607
5 SASI_Rn02_00219172 predicted 605
6 SASI_Rn02_00219173 predicted 462
7 SASI_Rn02_00219174 predicted 376
8 SASI_Rn02_00219175 predicted 428
9 SASI_Rn02_00219176 predicted 285
10 SASI_Rn02_00219177 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_002337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00452977 predicted 318
2 SASI_Mm02_00452978 predicted 584
3 SASI_Mm02_00452979 predicted 270
4 SASI_Mm02_00452980 predicted 702
5 SASI_Mm02_00452981 predicted 468
6 SASI_Mm02_00452982 predicted 1435
7 SASI_Mm02_00452983 predicted 1377
8 SASI_Mm02_00452984 predicted 590
9 SASI_Mm02_00452985 predicted 733
10 SASI_Mm02_00452986 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00453642 predicted 320
2 SASI_Mm02_00453643 predicted 579
3 SASI_Mm02_00453644 predicted 270
4 SASI_Mm02_00453645 predicted 703
5 SASI_Mm02_00453646 predicted 476
6 SASI_Mm02_00453647 predicted 1436
7 SASI_Mm02_00453648 predicted 1377
8 SASI_Mm02_00453649 predicted 589
9 SASI_Mm02_00453650 predicted 727
10 SASI_Mm02_00453651 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00482328 predicted 577
2 SASI_Mm02_00482329 predicted 272
3 SASI_Mm02_00482330 predicted 490
4 SASI_Mm02_00482331 predicted 320
5 SASI_Mm02_00482332 predicted 695
6 SASI_Mm02_00482333 predicted 515
7 SASI_Mm02_00482334 predicted 595
8 SASI_Mm02_00482335 predicted 499
9 SASI_Mm02_00482336 predicted 736
10 SASI_Mm02_00482337 predicted 701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010922
BCL2L15 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 15
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010922.1-509s1c1
Sequence:CCGGCTGGCAGTGTCAGTGAAACTTCTCGAGAAGTTTCACTGACACTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010922.1-371s1c1
Sequence:CCGGGAATTGGAAGCTTCTGCCAAACTCGAGTTTGGCAGAAGCTTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010922.2-4007s21c1
Sequence:CCGGAGCAACTGCCTGGACTATTAACTCGAGTTAATAGTCCAGGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010922.2-394s21c1
Sequence:CCGGCGTCATTGCAGAAACCATTAACTCGAGTTAATGGTTTCTGCAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010922.2-531s21c1
Sequence:CCGGTTGAGTACATGGCTCACATTGCTCGAGCAATGTGAGCCATGTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010922.2-582s21c1
Sequence:CCGGCCATGACGGGTATGATCAATGCTCGAGCATTGATCATACCCGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010922.2-477s21c1
Sequence:CCGGAGGATTCCAGCTTAGCTTATGCTCGAGCATAAGCTAAGCTGGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010922
BCL2L15 MISSION shRNA shRNA Plasmid DNA
BCL2-like 15
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010922.1-509s1c1
Sequence:CCGGCTGGCAGTGTCAGTGAAACTTCTCGAGAAGTTTCACTGACACTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010922.1-371s1c1
Sequence:CCGGGAATTGGAAGCTTCTGCCAAACTCGAGTTTGGCAGAAGCTTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010922.2-4007s21c1
Sequence:CCGGAGCAACTGCCTGGACTATTAACTCGAGTTAATAGTCCAGGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010922.2-394s21c1
Sequence:CCGGCGTCATTGCAGAAACCATTAACTCGAGTTAATGGTTTCTGCAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010922.2-531s21c1
Sequence:CCGGTTGAGTACATGGCTCACATTGCTCGAGCAATGTGAGCCATGTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010922.2-582s21c1
Sequence:CCGGCCATGACGGGTATGATCAATGCTCGAGCATTGATCATACCCGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010922.2-477s21c1
Sequence:CCGGAGGATTCCAGCTTAGCTTATGCTCGAGCATAAGCTAAGCTGGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010922
BCL2L15 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 15
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010922.1-509s1c1
Sequence:CCGGCTGGCAGTGTCAGTGAAACTTCTCGAGAAGTTTCACTGACACTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010922.1-371s1c1
Sequence:CCGGGAATTGGAAGCTTCTGCCAAACTCGAGTTTGGCAGAAGCTTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010922.2-4007s21c1
Sequence:CCGGAGCAACTGCCTGGACTATTAACTCGAGTTAATAGTCCAGGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010922.2-394s21c1
Sequence:CCGGCGTCATTGCAGAAACCATTAACTCGAGTTAATGGTTTCTGCAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010922.2-531s21c1
Sequence:CCGGTTGAGTACATGGCTCACATTGCTCGAGCAATGTGAGCCATGTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010922.2-582s21c1
Sequence:CCGGCCATGACGGGTATGATCAATGCTCGAGCATTGATCATACCCGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010922.2-477s21c1
Sequence:CCGGAGGATTCCAGCTTAGCTTATGCTCGAGCATAAGCTAAGCTGGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_149357
VALIDATED
BCL2L15 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149357.1-454s1c1
Sequence:CCGGGCCAATAATATCATTGCGGTACTCGAGTACCGCAATGATATTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149357.1-600s1c1
Sequence:CCGGTCTTGAATATGTGGTCCGTAACTCGAGTTACGGACCACATATTCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149357.1-441s1c1
Sequence:CCGGGCTGGAAGCTTCTGCCAATAACTCGAGTTATTGGCAGAAGCTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149357.1-267s1c1
Sequence:CCGGGCAAACAGAATGCATCGTGAACTCGAGTTCACGATGCATTCTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149357.1-362s1c1
Sequence:CCGGGCTCAGGAGAGGATTACTCTTCTCGAGAAGAGTAATCCTCTCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_149357
VALIDATED
BCL2L15 MISSION shRNA shRNA Plasmid DNA
BCL2-like 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149357.1-454s1c1
Sequence:CCGGGCCAATAATATCATTGCGGTACTCGAGTACCGCAATGATATTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149357.1-600s1c1
Sequence:CCGGTCTTGAATATGTGGTCCGTAACTCGAGTTACGGACCACATATTCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149357.1-441s1c1
Sequence:CCGGGCTGGAAGCTTCTGCCAATAACTCGAGTTATTGGCAGAAGCTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149357.1-267s1c1
Sequence:CCGGGCAAACAGAATGCATCGTGAACTCGAGTTCACGATGCATTCTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149357.1-362s1c1
Sequence:CCGGGCTCAGGAGAGGATTACTCTTCTCGAGAAGAGTAATCCTCTCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_149357
VALIDATED
BCL2L15 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_149357.1-454s1c1
Sequence:CCGGGCCAATAATATCATTGCGGTACTCGAGTACCGCAATGATATTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149357.1-600s1c1
Sequence:CCGGTCTTGAATATGTGGTCCGTAACTCGAGTTACGGACCACATATTCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149357.1-441s1c1
Sequence:CCGGGCTGGAAGCTTCTGCCAATAACTCGAGTTATTGGCAGAAGCTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149357.1-267s1c1
Sequence:CCGGGCAAACAGAATGCATCGTGAACTCGAGTTCACGATGCATTCTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_149357.1-362s1c1
Sequence:CCGGGCTCAGGAGAGGATTACTCTTCTCGAGAAGAGTAATCCTCTCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001142959
VALIDATED
BCL2L15 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001142959.1-267s21c1
Sequence:CCGGGCTCAGGAGAGGATTACTCTTCTCGAGAAGAGTAATCCTCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001142959.1-172s21c1
Sequence:CCGGGCAAACAGAATGCATCGTGAACTCGAGTTCACGATGCATTCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142959.1-346s21c1
Sequence:CCGGGCTGGAAGCTTCTGCCAATAACTCGAGTTATTGGCAGAAGCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001142959.1-446s21c1
Sequence:CCGGTGCACTCAGGATCCTACTTTACTCGAGTAAAGTAGGATCCTGAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001142959.1-582s21c1
Sequence:CCGGACACAGCCATCCGCGAGTTTACTCGAGTAAACTCGCGGATGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001142959
VALIDATED
BCL2L15 MISSION shRNA shRNA Plasmid DNA
BCL2-like 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001142959.1-267s21c1
Sequence:CCGGGCTCAGGAGAGGATTACTCTTCTCGAGAAGAGTAATCCTCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001142959.1-172s21c1
Sequence:CCGGGCAAACAGAATGCATCGTGAACTCGAGTTCACGATGCATTCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142959.1-346s21c1
Sequence:CCGGGCTGGAAGCTTCTGCCAATAACTCGAGTTATTGGCAGAAGCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001142959.1-446s21c1
Sequence:CCGGTGCACTCAGGATCCTACTTTACTCGAGTAAAGTAGGATCCTGAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001142959.1-582s21c1
Sequence:CCGGACACAGCCATCCGCGAGTTTACTCGAGTAAACTCGCGGATGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001142959
VALIDATED
BCL2L15 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001142959.1-267s21c1
Sequence:CCGGGCTCAGGAGAGGATTACTCTTCTCGAGAAGAGTAATCCTCTCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001142959.1-172s21c1
Sequence:CCGGGCAAACAGAATGCATCGTGAACTCGAGTTCACGATGCATTCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142959.1-346s21c1
Sequence:CCGGGCTGGAAGCTTCTGCCAATAACTCGAGTTATTGGCAGAAGCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001142959.1-446s21c1
Sequence:CCGGTGCACTCAGGATCCTACTTTACTCGAGTAAAGTAGGATCCTGAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001142959.1-582s21c1
Sequence:CCGGACACAGCCATCCGCGAGTTTACTCGAGTAAACTCGCGGATGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks