EMAIL THIS PAGE TO A FRIEND

BCL2L1

BCL2-like 1

230 Gene Product Result for
Synonyms: BCL-XL/S BCL2L BCLX BCLXL BCLXS Bcl-X PPP1R52 bcl-xL bcl-xS
UniProtKB ID: Q07817, E1P5L6, Q5CZ89, Q5TE65, Q92976
Gene ID:
Human(598) Summary: The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The proteins encoded by this gene are located at the outer mitochondrial membrane, and have been shown to regulate outer mitochondrial membrane channel (VDAC) opening. VDAC regulates mitochondrial membrane potential, and thus controls the production of reactive oxygen species and release of cytochrome C by mitochondria, both of which are the potent inducers of cell apoptosis. Two alternatively spliced transcript variants, which encode distinct isoforms, have been reported. The longer isoform acts as an apoptotic inhibitor and the shorter form acts as an apoptotic activator. [provided by RefSeq, Jul 2008]
Mouse(12048) BCL2-like 1
Rat(24888) Bcl2-like 1
sheep(443061) BCL2-like 1
Zebrafish(114401) bcl2-like 1
cow(282152) BCL2-like 1
domestic cat(493701) BCL2-like 1
dog(403618) BCL2-like 1
chicken(373954) BCL2-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B9304 Anti-Bcl-x antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunohistochemistry, microarray, western blot pricing
SAB3500349 Anti-Bcl-xL antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB4502623 Anti-BCL-XL antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502624 Anti-BCL-XL antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4502625 Anti-BCL-XL antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
GW21157 Anti-BCL2L1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
AV02008 Anti-BCL2L1 antibody produced in rabbit affinity isolated antibody bovine, human, rabbit, sheep, canine, pig
western blot pricing
AV30475 Anti-BCL2L1 antibody produced in rabbit IgG fraction of antiserum rabbit, rat, bovine, canine, pig, mouse, horse, sheep, human, guinea pig
western blot pricing
HPA035734 Anti-BCL2L1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2103893 Anti-BCL2L1, (N-terminal) antibody produced in rabbit affinity isolated antibody pig, sheep, mouse, bovine, rabbit, human, rat, canine, rabbit
western blot pricing
SAB4504352 Anti-phospho-BCL-XL (pSer62) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504083 Anti-phospho-BCL-XL (pThr47) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
B9429 Monoclonal Anti-Bcl-xL antibody produced in mouse ~2 mg/mL, clone 2H12, purified immunoglobulin, buffered aqueous solution human, rat, mouse
microarray, western blot pricing
SAB3300094 Monoclonal Anti-Bcl-XL antibody produced in mouse clone 4A9, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, western blot pricing
WH0000598M1 Monoclonal Anti-BCL2L1 antibody produced in mouse clone 3E2-2A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001191 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001191 Rosetta Predictions human pricing
NM_138578 Rosetta Predictions human pricing
NM_001033670 Rosetta Predictions rat pricing
NM_001033671 Rosetta Predictions rat pricing
NM_001033672 Rosetta Predictions rat pricing
NM_031535 Rosetta Predictions rat pricing
NM_009743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165963 predicted 1171
2 SASI_Hs01_00165964 predicted 424
3 SASI_Hs01_00165965 predicted 506
4 SASI_Hs01_00165966 predicted 435
5 SASI_Hs01_00165967 predicted 403
6 SASI_Hs01_00165968 predicted 419
7 SASI_Hs01_00165969 predicted 1168
8 SASI_Hs02_00331331 predicted 1263
9 SASI_Hs01_00165970 predicted 667
10 SASI_Hs01_00165971 predicted 830
11 SASI_Hs01_00165972 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235941 predicted 1365
2 SASI_Hs01_00235942 predicted 421
3 SASI_Hs01_00235943 predicted 513
4 SASI_Hs01_00235944 predicted 434
5 SASI_Hs01_00235945 predicted 404
6 SASI_Hs01_00235946 predicted 419
7 SASI_Hs01_00235947 predicted 1364
8 SASI_Hs02_00363733 predicted 1452
9 SASI_Hs01_00235948 predicted 726
10 SASI_Hs01_00235949 predicted 666
11 SASI_Hs01_00235950 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203671 predicted 1020
2 SASI_Rn01_00096475 predicted 319
3 SASI_Rn02_00203672 predicted 1021
4 SASI_Rn02_00203673 predicted 944
5 SASI_Rn02_00203674 predicted 1043
6 SASI_Rn01_00096473 predicted 481
7 SASI_Rn02_00203675 predicted 692
8 SASI_Rn02_00203676 predicted 530
9 SASI_Rn02_00203677 predicted 212
10 SASI_Rn02_00203678 predicted 823
11 SASI_Rn01_00096474 predicted 498
12 SASI_Rn01_00096476 predicted 504
13 SASI_Rn01_00096477 predicted 446
14 SASI_Rn01_00096478 predicted 450
15 SASI_Rn01_00096479 predicted 480
16 SASI_Rn01_00096480 predicted 487
17 SASI_Rn01_00096481 predicted 328
18 SASI_Rn01_00096482 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203679 predicted 761
2 SASI_Rn01_00039606 predicted 250
3 SASI_Rn02_00203680 predicted 773
4 SASI_Rn01_00039611 predicted 695
5 SASI_Rn02_00203681 predicted 787
6 SASI_Rn01_00039604 predicted 411
7 SASI_Rn01_00039605 predicted 474
8 SASI_Rn01_00039607 predicted 463
9 SASI_Rn02_00203682 predicted 147
10 SASI_Rn01_00039608 predicted 571
11 SASI_Rn01_00039603 predicted 829
12 SASI_Rn01_00039609 predicted 554
13 SASI_Rn01_00039610 predicted 436
14 SASI_Rn01_00039612 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101584 predicted 635
2 SASI_Rn01_00101585 predicted 650
3 SASI_Rn01_00101586 predicted 481
4 SASI_Rn01_00101587 predicted 654
5 SASI_Rn01_00101588 predicted 598
6 SASI_Rn01_00101589 predicted 596
7 SASI_Rn01_00101590 predicted 634
8 SASI_Rn01_00101591 predicted 631
9 SASI_Rn01_00101592 predicted 479
10 SASI_Rn02_00203683 predicted 644
11 SASI_Rn01_00101593 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066057 predicted 459
2 SASI_Rn01_00066058 predicted 481
3 SASI_Rn01_00066059 predicted 307
4 SASI_Rn01_00066060 predicted 479
5 SASI_Rn01_00066061 predicted 420
6 SASI_Rn01_00066062 predicted 430
7 SASI_Rn01_00066063 predicted 455
8 SASI_Rn01_00066064 predicted 462
9 SASI_Rn01_00066065 predicted 310
10 SASI_Rn02_00264693 predicted 470
11 SASI_Rn01_00066066 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316924 predicted 707
2 SASI_Mm02_00316925 predicted 658
3 SASI_Mm02_00316926 predicted 1266
4 SASI_Mm01_00154699 predicted 895
5 SASI_Mm01_00154701 predicted 333
6 SASI_Mm02_00316927 predicted 701
7 SASI_Mm01_00154703 predicted 264
8 SASI_Mm01_00154705 predicted 826
9 SASI_Mm02_00316928 predicted 1269
10 SASI_Mm01_00154706 predicted 664
11 SASI_Mm01_00154700 predicted 558
12 SASI_Mm01_00154702 predicted 637
13 SASI_Mm01_00154704 predicted 552
14 SASI_Mm01_00154707 predicted 585
15 SASI_Mm01_00154708 predicted 234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009743
VALIDATED
BCL2L1 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009743.2-883s1c1
Sequence:CCGGCAGGAGAACCACTACATGCAACTCGAGTTGCATGTAGTGGTTCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009743.2-676s1c1
Sequence:CCGGGTGGATCTCTACGGGAACAATCTCGAGATTGTTCCCGTAGAGATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009743.2-169s1c1
Sequence:CCGGAGCTGGAGTCAGTTTAGTGATCTCGAGATCACTAAACTGACTCCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009743.2-580s1c1
Sequence:CCGGCAGGTATTGGTGAGTCGGATTCTCGAGAATCCGACTCACCAATACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009743.2-384s1c1
Sequence:CCGGCGATGAGTTTGAACTGCGGTACTCGAGTACCGCAGTTCAAACTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009743.4-670s21c1
Sequence:CCGGCAGGTATTGGTGAGTCGGATTCTCGAGAATCCGACTCACCAATACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009743.4-474s21c1
Sequence:CCGGCGATGAGTTTGAACTGCGGTACTCGAGTACCGCAGTTCAAACTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009743.4-259s21c1
Sequence:CCGGAGCTGGAGTCAGTTTAGTGATCTCGAGATCACTAAACTGACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009743.4-973s21c1
Sequence:CCGGCAGGAGAACCACTACATGCAACTCGAGTTGCATGTAGTGGTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009743.4-766s21c1
Sequence:CCGGGTGGATCTCTACGGGAACAATCTCGAGATTGTTCCCGTAGAGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009743
VALIDATED
BCL2L1 MISSION shRNA shRNA Plasmid DNA
BCL2-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009743.2-883s1c1
Sequence:CCGGCAGGAGAACCACTACATGCAACTCGAGTTGCATGTAGTGGTTCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009743.2-676s1c1
Sequence:CCGGGTGGATCTCTACGGGAACAATCTCGAGATTGTTCCCGTAGAGATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009743.2-169s1c1
Sequence:CCGGAGCTGGAGTCAGTTTAGTGATCTCGAGATCACTAAACTGACTCCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009743.2-580s1c1
Sequence:CCGGCAGGTATTGGTGAGTCGGATTCTCGAGAATCCGACTCACCAATACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009743.2-384s1c1
Sequence:CCGGCGATGAGTTTGAACTGCGGTACTCGAGTACCGCAGTTCAAACTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009743.4-670s21c1
Sequence:CCGGCAGGTATTGGTGAGTCGGATTCTCGAGAATCCGACTCACCAATACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009743.4-474s21c1
Sequence:CCGGCGATGAGTTTGAACTGCGGTACTCGAGTACCGCAGTTCAAACTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009743.4-259s21c1
Sequence:CCGGAGCTGGAGTCAGTTTAGTGATCTCGAGATCACTAAACTGACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009743.4-973s21c1
Sequence:CCGGCAGGAGAACCACTACATGCAACTCGAGTTGCATGTAGTGGTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009743.4-766s21c1
Sequence:CCGGGTGGATCTCTACGGGAACAATCTCGAGATTGTTCCCGTAGAGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009743
VALIDATED
BCL2L1 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009743.2-883s1c1
Sequence:CCGGCAGGAGAACCACTACATGCAACTCGAGTTGCATGTAGTGGTTCTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009743.2-676s1c1
Sequence:CCGGGTGGATCTCTACGGGAACAATCTCGAGATTGTTCCCGTAGAGATCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009743.2-169s1c1
Sequence:CCGGAGCTGGAGTCAGTTTAGTGATCTCGAGATCACTAAACTGACTCCAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009743.2-580s1c1
Sequence:CCGGCAGGTATTGGTGAGTCGGATTCTCGAGAATCCGACTCACCAATACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009743.2-384s1c1
Sequence:CCGGCGATGAGTTTGAACTGCGGTACTCGAGTACCGCAGTTCAAACTCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009743.4-670s21c1
Sequence:CCGGCAGGTATTGGTGAGTCGGATTCTCGAGAATCCGACTCACCAATACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009743.4-474s21c1
Sequence:CCGGCGATGAGTTTGAACTGCGGTACTCGAGTACCGCAGTTCAAACTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009743.4-259s21c1
Sequence:CCGGAGCTGGAGTCAGTTTAGTGATCTCGAGATCACTAAACTGACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009743.4-973s21c1
Sequence:CCGGCAGGAGAACCACTACATGCAACTCGAGTTGCATGTAGTGGTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009743.4-766s21c1
Sequence:CCGGGTGGATCTCTACGGGAACAATCTCGAGATTGTTCCCGTAGAGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001191
VALIDATED
BCL2L1 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-728s1c1
Sequence:CCGGAGAGCTTTGAACAGGATACTTCTCGAGAAGTATCCTGTTCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-648s1c1
Sequence:CCGGCGACGAGTTTGAACTGCGGTACTCGAGTACCGCAGTTCAAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-444s1c1
Sequence:CCGGGTTTAGTGATGTGGAAGAGAACTCGAGTTCTCTTCCACATCACTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-751s1c1
Sequence:CCGGGTGGAACTCTATGGGAACAATCTCGAGATTGTTCCCATAGAGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-857s1c1
Sequence:CCGGGCTCACTCTTCAGTCGGAAATCTCGAGATTTCCGACTGAAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-648s21c1
Sequence:CCGGCGACGAGTTTGAACTGCGGTACTCGAGTACCGCAGTTCAAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-444s21c1
Sequence:CCGGGTTTAGTGATGTGGAAGAGAACTCGAGTTCTCTTCCACATCACTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-857s21c1
Sequence:CCGGGCTCACTCTTCAGTCGGAAATCTCGAGATTTCCGACTGAAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-728s21c1
Sequence:CCGGAGAGCTTTGAACAGGATACTTCTCGAGAAGTATCCTGTTCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-751s21c1
Sequence:CCGGGTGGAACTCTATGGGAACAATCTCGAGATTGTTCCCATAGAGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001191
VALIDATED
BCL2L1 MISSION shRNA shRNA Plasmid DNA
BCL2-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-728s1c1
Sequence:CCGGAGAGCTTTGAACAGGATACTTCTCGAGAAGTATCCTGTTCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-648s1c1
Sequence:CCGGCGACGAGTTTGAACTGCGGTACTCGAGTACCGCAGTTCAAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-444s1c1
Sequence:CCGGGTTTAGTGATGTGGAAGAGAACTCGAGTTCTCTTCCACATCACTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-751s1c1
Sequence:CCGGGTGGAACTCTATGGGAACAATCTCGAGATTGTTCCCATAGAGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-857s1c1
Sequence:CCGGGCTCACTCTTCAGTCGGAAATCTCGAGATTTCCGACTGAAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-648s21c1
Sequence:CCGGCGACGAGTTTGAACTGCGGTACTCGAGTACCGCAGTTCAAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-444s21c1
Sequence:CCGGGTTTAGTGATGTGGAAGAGAACTCGAGTTCTCTTCCACATCACTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-857s21c1
Sequence:CCGGGCTCACTCTTCAGTCGGAAATCTCGAGATTTCCGACTGAAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-728s21c1
Sequence:CCGGAGAGCTTTGAACAGGATACTTCTCGAGAAGTATCCTGTTCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-751s21c1
Sequence:CCGGGTGGAACTCTATGGGAACAATCTCGAGATTGTTCCCATAGAGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001191
VALIDATED
BCL2L1 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-728s1c1
Sequence:CCGGAGAGCTTTGAACAGGATACTTCTCGAGAAGTATCCTGTTCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-648s1c1
Sequence:CCGGCGACGAGTTTGAACTGCGGTACTCGAGTACCGCAGTTCAAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-444s1c1
Sequence:CCGGGTTTAGTGATGTGGAAGAGAACTCGAGTTCTCTTCCACATCACTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-751s1c1
Sequence:CCGGGTGGAACTCTATGGGAACAATCTCGAGATTGTTCCCATAGAGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001191.2-857s1c1
Sequence:CCGGGCTCACTCTTCAGTCGGAAATCTCGAGATTTCCGACTGAAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-648s21c1
Sequence:CCGGCGACGAGTTTGAACTGCGGTACTCGAGTACCGCAGTTCAAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-444s21c1
Sequence:CCGGGTTTAGTGATGTGGAAGAGAACTCGAGTTCTCTTCCACATCACTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-857s21c1
Sequence:CCGGGCTCACTCTTCAGTCGGAAATCTCGAGATTTCCGACTGAAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-728s21c1
Sequence:CCGGAGAGCTTTGAACAGGATACTTCTCGAGAAGTATCCTGTTCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001191.2-751s21c1
Sequence:CCGGGTGGAACTCTATGGGAACAATCTCGAGATTGTTCCCATAGAGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks