EMAIL THIS PAGE TO A FRIEND

BCL2L2

BCL2-like 2

275 Gene Product Result for
Synonyms: BCL-W BCL2-L-2 BCLW PPP1R51
UniProtKB ID: Q92843, A8K0F4, Q2M3U0, Q5U0H4
Gene ID:
Human(599) Summary: This gene encodes a member of the BCL-2 protein family. The proteins of this family form hetero- or homodimers and act as anti- and pro-apoptotic regulators. Expression of this gene in cells has been shown to contribute to reduced cell apoptosis under cytotoxic conditions. Studies of the related gene in mice indicated a role in the survival of NGF- and BDNF-dependent neurons. Mutation and knockout studies of the mouse gene demonstrated an essential role in adult spermatogenesis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream PABPN1 (poly(A) binding protein, nuclear 1) gene. [provided by RefSeq, Dec 2010]
Mouse(12050) BCL2-like 2
Rat(60434) Bcl2-like 2
domestic cat(768265) BCL2-like 2
cow(767601) BCL2-like 2
dog(490611) BCL2-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004050 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004050 Rosetta Predictions human pricing
NM_021850 Rosetta Predictions rat pricing
NM_007537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219328 predicted 1104
2 SASI_Hs01_00219329 predicted 887
3 SASI_Hs01_00219330 predicted 464
4 SASI_Hs01_00219331 predicted 1088
5 SASI_Hs01_00219332 predicted 893
6 SASI_Hs02_00336818 predicted 407
7 SASI_Hs02_00336819 predicted 255
8 SASI_Hs01_00219333 predicted 1029
9 SASI_Hs02_00336820 predicted 1159
10 SASI_Hs01_00219335 predicted 1147
11 SASI_Hs01_00219334 predicted 1093
12 SASI_Hs01_00219336 predicted 288
13 SASI_Hs01_00219337 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099049 predicted 1023
2 SASI_Rn02_00262875 predicted 1098
3 SASI_Rn01_00099050 predicted 1264
4 SASI_Rn01_00099051 predicted 1276
5 SASI_Rn01_00099054 predicted 1138
6 SASI_Rn01_00099056 predicted 1109
7 SASI_Rn01_00099057 predicted 843
8 SASI_Rn01_00099058 predicted 851
9 SASI_Rn02_00262876 predicted 771
10 SASI_Rn02_00262877 predicted 1162
11 SASI_Rn01_00099052 predicted 1081
12 SASI_Rn01_00099053 predicted 934
13 SASI_Rn01_00099055 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089791 predicted 409
2 SASI_Mm02_00311874 predicted 246
3 SASI_Mm01_00089792 predicted 332
4 SASI_Mm01_00089793 predicted 454
5 SASI_Mm01_00089794 predicted 1223
6 SASI_Mm01_00089795 predicted 337
7 SASI_Mm01_00089796 predicted 606
8 SASI_Mm01_00089797 predicted 1230
9 SASI_Mm01_00089798 predicted 459
10 SASI_Mm02_00311875 predicted 494
11 SASI_Mm01_00089799 predicted 460
12 SASI_Mm01_00089800 predicted 753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004050
BCL2L2 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004050.3-332s21c1
Sequence:CCGGAGCTGGAGATGAGTTCGAGACCTCGAGGTCTCGAACTCATCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004050.3-757s21c1
Sequence:CCGGTTGCTAGCAAGTGAAAGTCCACTCGAGTGGACTTTCACTTGCTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004050.3-1120s21c1
Sequence:CCGGCCATTAGATGAGTGGGATTTACTCGAGTAAATCCCACTCATCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004050.3-1088s21c1
Sequence:CCGGGAGGAAGGTGGACTTACATAACTCGAGTTATGTAAGTCCACCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004050.2-217s1c1
Sequence:CCGGTGGCAGACTTTGTAGGTTATACTCGAGTATAACCTACAAAGTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004050.2-507s1c1
Sequence:CCGGGTCAACAAGGAGATGGAACCACTCGAGTGGTTCCATCTCCTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004050.2-415s1c1
Sequence:CCGGCCCAGGTCTCCGATGAACTTTCTCGAGAAAGTTCATCGGAGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004050.2-246s1c1
Sequence:CCGGCAGAAGGGTTATGTCTGTGGACTCGAGTCCACAGACATAACCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004050
BCL2L2 MISSION shRNA shRNA Plasmid DNA
BCL2-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004050.3-332s21c1
Sequence:CCGGAGCTGGAGATGAGTTCGAGACCTCGAGGTCTCGAACTCATCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004050.3-757s21c1
Sequence:CCGGTTGCTAGCAAGTGAAAGTCCACTCGAGTGGACTTTCACTTGCTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004050.3-1120s21c1
Sequence:CCGGCCATTAGATGAGTGGGATTTACTCGAGTAAATCCCACTCATCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004050.3-1088s21c1
Sequence:CCGGGAGGAAGGTGGACTTACATAACTCGAGTTATGTAAGTCCACCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004050.2-217s1c1
Sequence:CCGGTGGCAGACTTTGTAGGTTATACTCGAGTATAACCTACAAAGTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004050.2-507s1c1
Sequence:CCGGGTCAACAAGGAGATGGAACCACTCGAGTGGTTCCATCTCCTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004050.2-415s1c1
Sequence:CCGGCCCAGGTCTCCGATGAACTTTCTCGAGAAAGTTCATCGGAGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004050.2-246s1c1
Sequence:CCGGCAGAAGGGTTATGTCTGTGGACTCGAGTCCACAGACATAACCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004050
BCL2L2 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004050.3-332s21c1
Sequence:CCGGAGCTGGAGATGAGTTCGAGACCTCGAGGTCTCGAACTCATCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004050.3-757s21c1
Sequence:CCGGTTGCTAGCAAGTGAAAGTCCACTCGAGTGGACTTTCACTTGCTAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004050.3-1120s21c1
Sequence:CCGGCCATTAGATGAGTGGGATTTACTCGAGTAAATCCCACTCATCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004050.3-1088s21c1
Sequence:CCGGGAGGAAGGTGGACTTACATAACTCGAGTTATGTAAGTCCACCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004050.2-217s1c1
Sequence:CCGGTGGCAGACTTTGTAGGTTATACTCGAGTATAACCTACAAAGTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004050.2-507s1c1
Sequence:CCGGGTCAACAAGGAGATGGAACCACTCGAGTGGTTCCATCTCCTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004050.2-415s1c1
Sequence:CCGGCCCAGGTCTCCGATGAACTTTCTCGAGAAAGTTCATCGGAGACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004050.2-246s1c1
Sequence:CCGGCAGAAGGGTTATGTCTGTGGACTCGAGTCCACAGACATAACCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007537
VALIDATED
BCL2L2 MISSION shRNA Bacterial Glycerol Stock
BCL2-like 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007537.1-498s21c1
Sequence:CCGGGTGCTGAGAGTGTCAACAAAGCTCGAGCTTTGTTGACACTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007537.1-610s21c1
Sequence:CCGGGGCGGAGTTCACAGCTCTATACTCGAGTATAGAGCTGTGAACTCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007537.1-459s21c1
Sequence:CCGGGCCGTCTTGTGGCATTCTTTGCTCGAGCAAAGAATGCCACAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007537.1-1070s21c1
Sequence:CCGGGACGGTGAGCTTACTTCAAAGCTCGAGCTTTGAAGTAAGCTCACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007537.1-220s21c1
Sequence:CCGGGGCTGACTTTGTAGGCTATAACTCGAGTTATAGCCTACAAAGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007537.1-911s1c1
Sequence:CCGGGCAGGGAGAATGAGTTGGAAACTCGAGTTTCCAACTCATTCTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007537.1-511s1c1
Sequence:CCGGCAACAAAGAAATGGAGCCTTTCTCGAGAAAGGCTCCATTTCTTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007537.1-417s1c1
Sequence:CCGGCCCAGGTTTCCGACGAACTTTCTCGAGAAAGTTCGTCGGAAACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007537.1-218s1c1
Sequence:CCGGGTGGCTGACTTTGTAGGCTATCTCGAGATAGCCTACAAAGTCAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007537.1-464s1c1
Sequence:CCGGCTTGTGGCATTCTTTGTCTTTCTCGAGAAAGACAAAGAATGCCACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007537
VALIDATED
BCL2L2 MISSION shRNA shRNA Plasmid DNA
BCL2-like 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007537.1-498s21c1
Sequence:CCGGGTGCTGAGAGTGTCAACAAAGCTCGAGCTTTGTTGACACTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007537.1-610s21c1
Sequence:CCGGGGCGGAGTTCACAGCTCTATACTCGAGTATAGAGCTGTGAACTCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007537.1-459s21c1
Sequence:CCGGGCCGTCTTGTGGCATTCTTTGCTCGAGCAAAGAATGCCACAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007537.1-1070s21c1
Sequence:CCGGGACGGTGAGCTTACTTCAAAGCTCGAGCTTTGAAGTAAGCTCACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007537.1-220s21c1
Sequence:CCGGGGCTGACTTTGTAGGCTATAACTCGAGTTATAGCCTACAAAGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007537.1-911s1c1
Sequence:CCGGGCAGGGAGAATGAGTTGGAAACTCGAGTTTCCAACTCATTCTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007537.1-511s1c1
Sequence:CCGGCAACAAAGAAATGGAGCCTTTCTCGAGAAAGGCTCCATTTCTTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007537.1-417s1c1
Sequence:CCGGCCCAGGTTTCCGACGAACTTTCTCGAGAAAGTTCGTCGGAAACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007537.1-218s1c1
Sequence:CCGGGTGGCTGACTTTGTAGGCTATCTCGAGATAGCCTACAAAGTCAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007537.1-464s1c1
Sequence:CCGGCTTGTGGCATTCTTTGTCTTTCTCGAGAAAGACAAAGAATGCCACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007537
VALIDATED
BCL2L2 MISSION shRNA Lentiviral Transduction Particles
BCL2-like 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007537.1-498s21c1
Sequence:CCGGGTGCTGAGAGTGTCAACAAAGCTCGAGCTTTGTTGACACTCTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007537.1-610s21c1
Sequence:CCGGGGCGGAGTTCACAGCTCTATACTCGAGTATAGAGCTGTGAACTCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007537.1-459s21c1
Sequence:CCGGGCCGTCTTGTGGCATTCTTTGCTCGAGCAAAGAATGCCACAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007537.1-1070s21c1
Sequence:CCGGGACGGTGAGCTTACTTCAAAGCTCGAGCTTTGAAGTAAGCTCACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007537.1-220s21c1
Sequence:CCGGGGCTGACTTTGTAGGCTATAACTCGAGTTATAGCCTACAAAGTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007537.1-911s1c1
Sequence:CCGGGCAGGGAGAATGAGTTGGAAACTCGAGTTTCCAACTCATTCTCCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007537.1-511s1c1
Sequence:CCGGCAACAAAGAAATGGAGCCTTTCTCGAGAAAGGCTCCATTTCTTTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007537.1-417s1c1
Sequence:CCGGCCCAGGTTTCCGACGAACTTTCTCGAGAAAGTTCGTCGGAAACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007537.1-218s1c1
Sequence:CCGGGTGGCTGACTTTGTAGGCTATCTCGAGATAGCCTACAAAGTCAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007537.1-464s1c1
Sequence:CCGGCTTGTGGCATTCTTTGTCTTTCTCGAGAAAGACAAAGAATGCCACAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks