EMAIL THIS PAGE TO A FRIEND

BCL3

B-cell CLL/lymphoma 3

Synonyms: BCL4 D19S37
UniProtKB ID: P20749
Gene ID:
Human(602) Summary: This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008]
Mouse(12051) B cell leukemia/lymphoma 3
Rat(680611) B-cell CLL/lymphoma 3
Zebrafish(565656) B-cell CLL/lymphoma 3
dog(612349) B-cell CLL/lymphoma 3
domestic cat(101096023) B-cell CLL/lymphoma 3
cow(531942) B-cell CLL/lymphoma 3
naked mole-rat(101713136) B-cell CLL/lymphoma 3
domestic guinea pig(100718288) B-cell CLL/lymphoma 3
sheep(101111483) B-cell CLL/lymphoma 3
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005178 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005178 Rosetta Predictions human pricing
NM_001109422 Rosetta Predictions rat pricing
NM_033601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112684 predicted 975
2 SASI_Hs01_00112685 predicted 600
3 SASI_Hs01_00112686 predicted 899
4 SASI_Hs01_00112687 predicted 924
5 SASI_Hs01_00112688 predicted 511
6 SASI_Hs01_00112689 predicted 867
7 SASI_Hs01_00112690 predicted 860
8 SASI_Hs01_00112691 predicted 830
9 SASI_Hs01_00112692 predicted 961
10 SASI_Hs01_00112693 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248257 predicted 439
2 SASI_Rn02_00248258 predicted 416
3 SASI_Rn02_00248259 predicted 1555
4 SASI_Rn02_00248260 predicted 877
5 SASI_Rn02_00248261 predicted 814
6 SASI_Rn02_00248262 predicted 574
7 SASI_Rn02_00248263 predicted 1546
8 SASI_Rn02_00248264 predicted 1441
9 SASI_Rn02_00248265 predicted 1508
10 SASI_Rn02_00248266 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118272 predicted 610
2 SASI_Mm01_00118273 predicted 962
3 SASI_Mm01_00118274 predicted 1060
4 SASI_Mm01_00118275 predicted 314
5 SASI_Mm01_00118276 predicted 549
6 SASI_Mm01_00118277 predicted 854
7 SASI_Mm01_00118278 predicted 916
8 SASI_Mm01_00118279 predicted 856
9 SASI_Mm01_00118280 predicted 855
10 SASI_Mm01_00118281 predicted 893
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005178
VALIDATED
BCL3 MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005178.2-510s1c1
Sequence:CCGGCTCGACATCTACAACAACCTACTCGAGTAGGTTGTTGTAGATGTCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005178.2-914s1c1
Sequence:CCGGCGCCAACGTGAACGCGCAAATCTCGAGATTTGCGCGTTCACGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005178.2-272s1c1
Sequence:CCGGCGGAGCCTTACTGCCTTTGTACTCGAGTACAAAGGCAGTAAGGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005178.2-1013s1c1
Sequence:CCGGCGCTGACAGCAGCCTCAAGAACTCGAGTTCTTGAGGCTGCTGTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005178.2-1269s1c1
Sequence:CCGGCCTCCCAATTTCTTCCTTCCTCTCGAGAGGAAGGAAGAAATTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005178.4-325s21c1
Sequence:CCGGCGGAGCCTTACTGCCTTTGTACTCGAGTACAAAGGCAGTAAGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005178.4-1066s21c1
Sequence:CCGGCGCTGACAGCAGCCTCAAGAACTCGAGTTCTTGAGGCTGCTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005178.4-1677s21c1
Sequence:CCGGTGCCACCCACATCTTCCATTTCTCGAGAAATGGAAGATGTGGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005178.4-967s21c1
Sequence:CCGGCGCCAACGTGAACGCGCAAATCTCGAGATTTGCGCGTTCACGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005178
VALIDATED
BCL3 MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005178.2-510s1c1
Sequence:CCGGCTCGACATCTACAACAACCTACTCGAGTAGGTTGTTGTAGATGTCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005178.2-914s1c1
Sequence:CCGGCGCCAACGTGAACGCGCAAATCTCGAGATTTGCGCGTTCACGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005178.2-272s1c1
Sequence:CCGGCGGAGCCTTACTGCCTTTGTACTCGAGTACAAAGGCAGTAAGGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005178.2-1013s1c1
Sequence:CCGGCGCTGACAGCAGCCTCAAGAACTCGAGTTCTTGAGGCTGCTGTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005178.2-1269s1c1
Sequence:CCGGCCTCCCAATTTCTTCCTTCCTCTCGAGAGGAAGGAAGAAATTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005178.4-325s21c1
Sequence:CCGGCGGAGCCTTACTGCCTTTGTACTCGAGTACAAAGGCAGTAAGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005178.4-1066s21c1
Sequence:CCGGCGCTGACAGCAGCCTCAAGAACTCGAGTTCTTGAGGCTGCTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005178.4-1677s21c1
Sequence:CCGGTGCCACCCACATCTTCCATTTCTCGAGAAATGGAAGATGTGGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005178.4-967s21c1
Sequence:CCGGCGCCAACGTGAACGCGCAAATCTCGAGATTTGCGCGTTCACGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005178
VALIDATED
BCL3 MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005178.2-510s1c1
Sequence:CCGGCTCGACATCTACAACAACCTACTCGAGTAGGTTGTTGTAGATGTCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005178.2-914s1c1
Sequence:CCGGCGCCAACGTGAACGCGCAAATCTCGAGATTTGCGCGTTCACGTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005178.2-272s1c1
Sequence:CCGGCGGAGCCTTACTGCCTTTGTACTCGAGTACAAAGGCAGTAAGGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005178.2-1013s1c1
Sequence:CCGGCGCTGACAGCAGCCTCAAGAACTCGAGTTCTTGAGGCTGCTGTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005178.2-1269s1c1
Sequence:CCGGCCTCCCAATTTCTTCCTTCCTCTCGAGAGGAAGGAAGAAATTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005178.4-325s21c1
Sequence:CCGGCGGAGCCTTACTGCCTTTGTACTCGAGTACAAAGGCAGTAAGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005178.4-1066s21c1
Sequence:CCGGCGCTGACAGCAGCCTCAAGAACTCGAGTTCTTGAGGCTGCTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005178.4-1677s21c1
Sequence:CCGGTGCCACCCACATCTTCCATTTCTCGAGAAATGGAAGATGTGGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005178.4-967s21c1
Sequence:CCGGCGCCAACGTGAACGCGCAAATCTCGAGATTTGCGCGTTCACGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033601
VALIDATED
BCL3 MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033601.1-267s1c1
Sequence:CCGGCCTTTACTACCAGGGACCTTTCTCGAGAAAGGTCCCTGGTAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033601.1-736s1c1
Sequence:CCGGCGCAATTATGAAGGGCTCACTCTCGAGAGTGAGCCCTTCATAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033601.1-476s1c1
Sequence:CCGGTCTACCGAATACTCAGCCTTTCTCGAGAAAGGCTGAGTATTCGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033601.1-1032s1c1
Sequence:CCGGCCTCAAGAACTGTCACAATGACTCGAGTCATTGTGACAGTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033601.1-1242s1c1
Sequence:CCGGCCCGAAAGATGCTCCTGGCTTCTCGAGAAGCCAGGAGCATCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033601.3-1657s21c1
Sequence:GTACCGGGAATCCACCAGATACTCAATTCTCGAGAATTGAGTATCTGGTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033601.3-965s21c1
Sequence:CCGGACGTGAACGCTCAGATGTATTCTCGAGAATACATCTGAGCGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033601.3-549s21c1
Sequence:CCGGCCGCGAAGTAGACGTCCATAACTCGAGTTATGGACGTCTACTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033601.3-318s21c1
Sequence:CCGGGGGACCTTTGATGCCCATTTACTCGAGTAAATGGGCATCAAAGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033601
VALIDATED
BCL3 MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033601.1-267s1c1
Sequence:CCGGCCTTTACTACCAGGGACCTTTCTCGAGAAAGGTCCCTGGTAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033601.1-736s1c1
Sequence:CCGGCGCAATTATGAAGGGCTCACTCTCGAGAGTGAGCCCTTCATAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033601.1-476s1c1
Sequence:CCGGTCTACCGAATACTCAGCCTTTCTCGAGAAAGGCTGAGTATTCGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033601.1-1032s1c1
Sequence:CCGGCCTCAAGAACTGTCACAATGACTCGAGTCATTGTGACAGTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033601.1-1242s1c1
Sequence:CCGGCCCGAAAGATGCTCCTGGCTTCTCGAGAAGCCAGGAGCATCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033601.3-1657s21c1
Sequence:GTACCGGGAATCCACCAGATACTCAATTCTCGAGAATTGAGTATCTGGTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033601.3-965s21c1
Sequence:CCGGACGTGAACGCTCAGATGTATTCTCGAGAATACATCTGAGCGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033601.3-549s21c1
Sequence:CCGGCCGCGAAGTAGACGTCCATAACTCGAGTTATGGACGTCTACTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033601.3-318s21c1
Sequence:CCGGGGGACCTTTGATGCCCATTTACTCGAGTAAATGGGCATCAAAGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033601
VALIDATED
BCL3 MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033601.1-267s1c1
Sequence:CCGGCCTTTACTACCAGGGACCTTTCTCGAGAAAGGTCCCTGGTAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033601.1-736s1c1
Sequence:CCGGCGCAATTATGAAGGGCTCACTCTCGAGAGTGAGCCCTTCATAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033601.1-476s1c1
Sequence:CCGGTCTACCGAATACTCAGCCTTTCTCGAGAAAGGCTGAGTATTCGGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033601.1-1032s1c1
Sequence:CCGGCCTCAAGAACTGTCACAATGACTCGAGTCATTGTGACAGTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033601.1-1242s1c1
Sequence:CCGGCCCGAAAGATGCTCCTGGCTTCTCGAGAAGCCAGGAGCATCTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033601.3-1657s21c1
Sequence:GTACCGGGAATCCACCAGATACTCAATTCTCGAGAATTGAGTATCTGGTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033601.3-965s21c1
Sequence:CCGGACGTGAACGCTCAGATGTATTCTCGAGAATACATCTGAGCGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033601.3-549s21c1
Sequence:CCGGCCGCGAAGTAGACGTCCATAACTCGAGTTATGGACGTCTACTTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033601.3-318s21c1
Sequence:CCGGGGGACCTTTGATGCCCATTTACTCGAGTAAATGGGCATCAAAGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks