EMAIL THIS PAGE TO A FRIEND

BCL6B

B-cell CLL/lymphoma 6, member B

Synonyms: BAZF ZBTB28 ZNF62
UniProtKB ID: Q8N143, Q6PCB4
Gene ID:
Mouse(12029) B cell CLL/lymphoma 6, member B
Rat(360551) B-cell CLL/lymphoma 6, member B
dog(489459) B-cell CLL/lymphoma 6, member B
Horse(100147131) B-cell CLL/lymphoma 6, member B
cow(100138731) B-cell CLL/lymphoma 6, member B
domestic cat(101094801) B-cell CLL/lymphoma 6, member B
naked mole-rat(101704395) B-cell CLL/lymphoma 6, member B
domestic guinea pig(100718471) B-cell CLL/lymphoma 6, member B
sheep(101114452) B-cell CLL/lymphoma 6, member B
153 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181844 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043391 MISSION® esiRNA esiRNA human BCL6B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181844 Rosetta Predictions human pricing
NM_001108279 Rosetta Predictions rat pricing
NM_007528 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238855 predicted 1465
2 SASI_Hs01_00238856 predicted 332
3 SASI_Hs01_00238857 predicted 332
4 SASI_Hs01_00238858 predicted 1395
5 SASI_Hs01_00238859 predicted 1405
6 SASI_Hs01_00238860 predicted 1034
7 SASI_Hs01_00238861 predicted 1454
8 SASI_Hs01_00238862 predicted 439
9 SASI_Hs01_00238863 predicted 1757
10 SASI_Hs01_00238864 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237094 predicted 1501
2 SASI_Rn02_00237095 predicted 1789
3 SASI_Rn02_00237096 predicted 350
4 SASI_Rn02_00237097 predicted 407
5 SASI_Rn02_00237098 predicted 966
6 SASI_Rn02_00237099 predicted 1684
7 SASI_Rn02_00237100 predicted 949
8 SASI_Rn02_00237101 predicted 389
9 SASI_Rn02_00237102 predicted 1598
10 SASI_Rn02_00237103 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117681 predicted 367
2 SASI_Mm01_00117682 predicted 361
3 SASI_Mm01_00117683 predicted 765
4 SASI_Mm01_00117684 predicted 661
5 SASI_Mm01_00117685 predicted 1080
6 SASI_Mm01_00117686 predicted 423
7 SASI_Mm02_00311844 predicted 367
8 SASI_Mm01_00117688 predicted 398
9 SASI_Mm01_00117689 predicted 298
10 SASI_Mm01_00117690 predicted 618
11 SASI_Mm01_00117687 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007528
BCL6B MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 6, member B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007528.1-1735s1c1
Sequence:CCGGCCTCCATTTCAAATGGTTTATCTCGAGATAAACCATTTGAAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007528.1-90s1c1
Sequence:CCGGCGACGTGCTTAGCAATCTGAACTCGAGTTCAGATTGCTAAGCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007528.1-871s1c1
Sequence:CCGGGCTTCTAAGCAGGCTAATCCACTCGAGTGGATTAGCCTGCTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007528.1-770s1c1
Sequence:CCGGGCAGACTATCTCTAGCTACTACTCGAGTAGTAGCTAGAGATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007528.1-1017s1c1
Sequence:CCGGCTTCCGTTATAAGGGCAACTTCTCGAGAAGTTGCCCTTATAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007528.2-1104s21c1
Sequence:CCGGTAACCGACCTGCTAACCTAAACTCGAGTTTAGGTTAGCAGGTCGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007528.2-807s21c1
Sequence:CCGGGTGTGGAGCTCTAGCAAATAACTCGAGTTATTTGCTAGAGCTCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007528
BCL6B MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 6, member B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007528.1-1735s1c1
Sequence:CCGGCCTCCATTTCAAATGGTTTATCTCGAGATAAACCATTTGAAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007528.1-90s1c1
Sequence:CCGGCGACGTGCTTAGCAATCTGAACTCGAGTTCAGATTGCTAAGCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007528.1-871s1c1
Sequence:CCGGGCTTCTAAGCAGGCTAATCCACTCGAGTGGATTAGCCTGCTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007528.1-770s1c1
Sequence:CCGGGCAGACTATCTCTAGCTACTACTCGAGTAGTAGCTAGAGATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007528.1-1017s1c1
Sequence:CCGGCTTCCGTTATAAGGGCAACTTCTCGAGAAGTTGCCCTTATAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007528.2-1104s21c1
Sequence:CCGGTAACCGACCTGCTAACCTAAACTCGAGTTTAGGTTAGCAGGTCGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007528.2-807s21c1
Sequence:CCGGGTGTGGAGCTCTAGCAAATAACTCGAGTTATTTGCTAGAGCTCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007528
BCL6B MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 6, member B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007528.1-1735s1c1
Sequence:CCGGCCTCCATTTCAAATGGTTTATCTCGAGATAAACCATTTGAAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007528.1-90s1c1
Sequence:CCGGCGACGTGCTTAGCAATCTGAACTCGAGTTCAGATTGCTAAGCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007528.1-871s1c1
Sequence:CCGGGCTTCTAAGCAGGCTAATCCACTCGAGTGGATTAGCCTGCTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007528.1-770s1c1
Sequence:CCGGGCAGACTATCTCTAGCTACTACTCGAGTAGTAGCTAGAGATAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007528.1-1017s1c1
Sequence:CCGGCTTCCGTTATAAGGGCAACTTCTCGAGAAGTTGCCCTTATAACGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007528.2-1104s21c1
Sequence:CCGGTAACCGACCTGCTAACCTAAACTCGAGTTTAGGTTAGCAGGTCGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007528.2-807s21c1
Sequence:CCGGGTGTGGAGCTCTAGCAAATAACTCGAGTTATTTGCTAGAGCTCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181844
BCL6B MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 6, member B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-650s1c1
Sequence:CCGGGTACAAGTACATCGTGCTAAACTCGAGTTTAGCACGATGTACTTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-239s1c1
Sequence:CCGGCAGTGGCTTCTTCTATTCAATCTCGAGATTGAATAGAAGAAGCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-1190s1c1
Sequence:CCGGCCGCATCCATTCGGGAGAGAACTCGAGTTCTCTCCCGAATGGATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-1064s1c1
Sequence:CCGGCCGGTCTTCGTTCCGCTACAACTCGAGTTGTAGCGGAACGAAGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-332s1c1
Sequence:CCGGCCCTCTATTGGACTTCATGTACTCGAGTACATGAAGTCCAATAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181844.3-1820s21c1
Sequence:CCGGTGCATTCAGTTTATCTGTAAACTCGAGTTTACAGATAAACTGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181844.3-1619s21c1
Sequence:CCGGGAAATTGCCACCCTCTTAATTCTCGAGAATTAAGAGGGTGGCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181844.3-1127s21c1
Sequence:CCGGGCCTTACCACTGCTCAATCTGCTCGAGCAGATTGAGCAGTGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181844
BCL6B MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 6, member B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-650s1c1
Sequence:CCGGGTACAAGTACATCGTGCTAAACTCGAGTTTAGCACGATGTACTTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-239s1c1
Sequence:CCGGCAGTGGCTTCTTCTATTCAATCTCGAGATTGAATAGAAGAAGCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-1190s1c1
Sequence:CCGGCCGCATCCATTCGGGAGAGAACTCGAGTTCTCTCCCGAATGGATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-1064s1c1
Sequence:CCGGCCGGTCTTCGTTCCGCTACAACTCGAGTTGTAGCGGAACGAAGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-332s1c1
Sequence:CCGGCCCTCTATTGGACTTCATGTACTCGAGTACATGAAGTCCAATAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181844.3-1820s21c1
Sequence:CCGGTGCATTCAGTTTATCTGTAAACTCGAGTTTACAGATAAACTGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181844.3-1619s21c1
Sequence:CCGGGAAATTGCCACCCTCTTAATTCTCGAGAATTAAGAGGGTGGCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181844.3-1127s21c1
Sequence:CCGGGCCTTACCACTGCTCAATCTGCTCGAGCAGATTGAGCAGTGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181844
BCL6B MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 6, member B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-650s1c1
Sequence:CCGGGTACAAGTACATCGTGCTAAACTCGAGTTTAGCACGATGTACTTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-239s1c1
Sequence:CCGGCAGTGGCTTCTTCTATTCAATCTCGAGATTGAATAGAAGAAGCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-1190s1c1
Sequence:CCGGCCGCATCCATTCGGGAGAGAACTCGAGTTCTCTCCCGAATGGATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-1064s1c1
Sequence:CCGGCCGGTCTTCGTTCCGCTACAACTCGAGTTGTAGCGGAACGAAGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181844.2-332s1c1
Sequence:CCGGCCCTCTATTGGACTTCATGTACTCGAGTACATGAAGTCCAATAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181844.3-1820s21c1
Sequence:CCGGTGCATTCAGTTTATCTGTAAACTCGAGTTTACAGATAAACTGAATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181844.3-1619s21c1
Sequence:CCGGGAAATTGCCACCCTCTTAATTCTCGAGAATTAAGAGGGTGGCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181844.3-1127s21c1
Sequence:CCGGGCCTTACCACTGCTCAATCTGCTCGAGCAGATTGAGCAGTGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks