EMAIL THIS PAGE TO A FRIEND

BCL7A

B-cell CLL/lymphoma 7A

220 Gene Product Result for
Synonyms: BCL7
UniProtKB ID: Q4VC05, B4DJN6, B7ZB21, Q13843, Q14CT7
Gene ID:
Human(605) Summary: This gene is directly involved, with Myc and IgH, in a three-way gene translocation in a Burkitt lymphoma cell line. As a result of the gene translocation, the N-terminal region of the gene product is disrupted, which is thought to be related to the pathogenesis of a subset of high-grade B cell non-Hodgkin lymphoma. The N-terminal segment involved in the translocation includes the region that shares a strong sequence similarity with those of BCL7B and BCL7C. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(77045) B cell CLL/lymphoma 7A
Rat(360809) B-cell CLL/lymphoma 7A
Zebrafish(57952) B-cell CLL/lymphoma 7A
chicken(416856) B-cell CLL/lymphoma 7A
dog(486256) B-cell CLL/lymphoma 7A
domestic cat(101095922) B-cell CLL/lymphoma 7A
cow(616240) B-cell CLL/lymphoma 7A
sheep(101103013) B-cell CLL/lymphoma 7A
domestic guinea pig(100714081) B-cell CLL/lymphoma 7A
naked mole-rat(101706586) B-cell CLL/lymphoma 7A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020993 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024808 Rosetta Predictions human pricing
NM_020993 Rosetta Predictions human pricing
XM_341081 Rosetta Predictions rat pricing
NM_029850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136654 predicted 1162
2 SASI_Hs01_00136655 predicted 247
3 SASI_Hs01_00136656 predicted 963
4 SASI_Hs01_00136657 predicted 1209
5 SASI_Hs01_00136658 predicted 392
6 SASI_Hs01_00136659 predicted 1072
7 SASI_Hs01_00136660 predicted 1111
8 SASI_Hs02_00307249 predicted 922
9 SASI_Hs01_00136661 predicted 1240
10 SASI_Hs01_00136662 predicted 998
11 SASI_Hs01_00136663 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102215 predicted 1223
2 SASI_Hs01_00102216 predicted 246
3 SASI_Hs01_00102217 predicted 1022
4 SASI_Hs01_00102218 predicted 1270
5 SASI_Hs01_00102219 predicted 385
6 SASI_Hs01_00102220 predicted 1135
7 SASI_Hs01_00102221 predicted 1176
8 SASI_Hs02_00354456 predicted 984
9 SASI_Hs01_00102222 predicted 1306
10 SASI_Hs01_00102223 predicted 1066
11 SASI_Hs01_00102224 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00197059 predicted 1784
2 SASI_Rn01_00197060 predicted 1974
3 SASI_Rn01_00197061 predicted 1622
4 SASI_Rn01_00197062 predicted 766
5 SASI_Rn01_00197063 predicted 1792
6 SASI_Rn01_00197064 predicted 695
7 SASI_Rn01_00197065 predicted 2194
8 SASI_Rn01_00197066 predicted 660
9 SASI_Rn01_00197067 predicted 411
10 SASI_Rn01_00197068 predicted 1902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034547 predicted 1217
2 SASI_Mm01_00034548 predicted 651
3 SASI_Mm01_00034549 predicted 836
4 SASI_Mm01_00034550 predicted 747
5 SASI_Mm01_00034551 predicted 1138
6 SASI_Mm01_00034552 predicted 672
7 SASI_Mm01_00034554 predicted 916
8 SASI_Mm01_00034555 predicted 1078
9 SASI_Mm02_00336074 predicted 1057
10 SASI_Mm01_00034556 predicted 1006
11 SASI_Mm01_00034553 predicted 1065
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020993
VALIDATED
BCL7A MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 7A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020993.3-184s21c1
Sequence:CCGGATGATATCAAGAGGGTCATGGCTCGAGCCATGACCCTCTTGATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020993.3-768s21c1
Sequence:CCGGGAAGGAGTGCCACCCTCTAAACTCGAGTTTAGAGGGTGGCACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020993.3-792s21c1
Sequence:CCGGATGAAACTGGAGGCCTCTCAACTCGAGTTGAGAGGCCTCCAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020993.3-1148s21c1
Sequence:CCGGTTCTCTATGTAACGATATAAGCTCGAGCTTATATCGTTACATAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020993.3-826s21c1
Sequence:CCGGAGATGTAGACGATGCTTTAAACTCGAGTTTAAAGCATCGTCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1077s1c1
Sequence:CCGGCATCCCTACGAATCTACAAATCTCGAGATTTGTAGATTCGTAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1112s1c1
Sequence:CCGGGAGCCCAAGGTTGATGACAAACTCGAGTTTGTCATCAACCTTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1049s1c1
Sequence:CCGGGAGAAGAAATGGGTGACCGTTCTCGAGAACGGTCACCCATTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1213s1c1
Sequence:CCGGGATGGACATGCATGACGATAACTCGAGTTATCGTCATGCATGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1422s1c1
Sequence:CCGGCCTCGATGGAACATTCGATGACTCGAGTCATCGAATGTTCCATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020993
VALIDATED
BCL7A MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 7A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020993.3-184s21c1
Sequence:CCGGATGATATCAAGAGGGTCATGGCTCGAGCCATGACCCTCTTGATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020993.3-768s21c1
Sequence:CCGGGAAGGAGTGCCACCCTCTAAACTCGAGTTTAGAGGGTGGCACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020993.3-792s21c1
Sequence:CCGGATGAAACTGGAGGCCTCTCAACTCGAGTTGAGAGGCCTCCAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020993.3-1148s21c1
Sequence:CCGGTTCTCTATGTAACGATATAAGCTCGAGCTTATATCGTTACATAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020993.3-826s21c1
Sequence:CCGGAGATGTAGACGATGCTTTAAACTCGAGTTTAAAGCATCGTCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1077s1c1
Sequence:CCGGCATCCCTACGAATCTACAAATCTCGAGATTTGTAGATTCGTAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1112s1c1
Sequence:CCGGGAGCCCAAGGTTGATGACAAACTCGAGTTTGTCATCAACCTTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1049s1c1
Sequence:CCGGGAGAAGAAATGGGTGACCGTTCTCGAGAACGGTCACCCATTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1213s1c1
Sequence:CCGGGATGGACATGCATGACGATAACTCGAGTTATCGTCATGCATGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1422s1c1
Sequence:CCGGCCTCGATGGAACATTCGATGACTCGAGTCATCGAATGTTCCATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020993
VALIDATED
BCL7A MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 7A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020993.3-184s21c1
Sequence:CCGGATGATATCAAGAGGGTCATGGCTCGAGCCATGACCCTCTTGATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020993.3-768s21c1
Sequence:CCGGGAAGGAGTGCCACCCTCTAAACTCGAGTTTAGAGGGTGGCACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020993.3-792s21c1
Sequence:CCGGATGAAACTGGAGGCCTCTCAACTCGAGTTGAGAGGCCTCCAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020993.3-1148s21c1
Sequence:CCGGTTCTCTATGTAACGATATAAGCTCGAGCTTATATCGTTACATAGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020993.3-826s21c1
Sequence:CCGGAGATGTAGACGATGCTTTAAACTCGAGTTTAAAGCATCGTCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1077s1c1
Sequence:CCGGCATCCCTACGAATCTACAAATCTCGAGATTTGTAGATTCGTAGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1112s1c1
Sequence:CCGGGAGCCCAAGGTTGATGACAAACTCGAGTTTGTCATCAACCTTGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1049s1c1
Sequence:CCGGGAGAAGAAATGGGTGACCGTTCTCGAGAACGGTCACCCATTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1213s1c1
Sequence:CCGGGATGGACATGCATGACGATAACTCGAGTTATCGTCATGCATGTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020993.2-1422s1c1
Sequence:CCGGCCTCGATGGAACATTCGATGACTCGAGTCATCGAATGTTCCATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029850
BCL7A MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 7A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029850.2-1982s1c1
Sequence:CCGGCGGGAAGATTTGCACACAGATCTCGAGATCTGTGTGCAAATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029850.2-221s1c1
Sequence:CCGGTGGCGATACATCCCTACGAATCTCGAGATTCGTAGGGATGTATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029850.2-374s1c1
Sequence:CCGGGCACGATGATAACAGCAACCACTCGAGTGGTTGCTGTTATCATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029850.2-262s1c1
Sequence:CCGGCGGAGCCAAAGGTTGATGATACTCGAGTATCATCAACCTTTGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029850.2-657s1c1
Sequence:CCGGGCAGTCTCTCAGGATTTGGAACTCGAGTTCCAAATCCTGAGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029850
BCL7A MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 7A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029850.2-1982s1c1
Sequence:CCGGCGGGAAGATTTGCACACAGATCTCGAGATCTGTGTGCAAATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029850.2-221s1c1
Sequence:CCGGTGGCGATACATCCCTACGAATCTCGAGATTCGTAGGGATGTATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029850.2-374s1c1
Sequence:CCGGGCACGATGATAACAGCAACCACTCGAGTGGTTGCTGTTATCATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029850.2-262s1c1
Sequence:CCGGCGGAGCCAAAGGTTGATGATACTCGAGTATCATCAACCTTTGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029850.2-657s1c1
Sequence:CCGGGCAGTCTCTCAGGATTTGGAACTCGAGTTCCAAATCCTGAGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029850
BCL7A MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 7A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029850.2-1982s1c1
Sequence:CCGGCGGGAAGATTTGCACACAGATCTCGAGATCTGTGTGCAAATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029850.2-221s1c1
Sequence:CCGGTGGCGATACATCCCTACGAATCTCGAGATTCGTAGGGATGTATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029850.2-374s1c1
Sequence:CCGGGCACGATGATAACAGCAACCACTCGAGTGGTTGCTGTTATCATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029850.2-262s1c1
Sequence:CCGGCGGAGCCAAAGGTTGATGATACTCGAGTATCATCAACCTTTGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029850.2-657s1c1
Sequence:CCGGGCAGTCTCTCAGGATTTGGAACTCGAGTTCCAAATCCTGAGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks