EMAIL THIS PAGE TO A FRIEND

BCL7B

B-cell CLL/lymphoma 7B

124 Gene Product Result for
Gene ID:
Human(9275) Summary: This gene encodes a member of the BCL7 family including BCL7A, BCL7B and BCL7C proteins. This member is BCL7B, which contains a region that is highly similar to the N-terminal segment of BCL7A or BCL7C proteins. The BCL7A protein is encoded by the gene known to be directly involved in a three-way gene translocation in a Burkitt lymphoma cell line. This gene is located at a chromosomal region commonly deleted in Williams syndrome. This gene is highly conserved from C. elegans to human. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2010]
Mouse(12054) B cell CLL/lymphoma 7B
Rat(368001) B-cell CLL/lymphoma 7B
naked mole-rat(101707529) B-cell CLL/lymphoma 7B
domestic guinea pig(100733414) B-cell CLL/lymphoma 7B
sheep(101113721) B-cell CLL/lymphoma 7B
chicken(100857890) B-cell CLL/lymphoma 7B
cow(615062) B-cell CLL/lymphoma 7B
domestic cat(101087956) B-cell CLL/lymphoma 7B
dog(489808) B-cell CLL/lymphoma 7B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001707 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001707 Rosetta Predictions human pricing
NM_138707 Rosetta Predictions human pricing
NM_001109021 Rosetta Predictions rat pricing
NM_009745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332386 predicted 586
2 SASI_Hs02_00332387 predicted 402
3 SASI_Hs02_00332388 predicted 492
4 SASI_Hs02_00332389 predicted 1039
5 SASI_Hs01_00198098 predicted 326
6 SASI_Hs01_00198101 predicted 331
7 SASI_Hs02_00332390 predicted 1185
8 SASI_Hs02_00332391 predicted 466
9 SASI_Hs02_00332392 predicted 918
10 SASI_Hs01_00198103 predicted 351
11 SASI_Hs01_00198097 predicted 315
12 SASI_Hs01_00198099 predicted 355
13 SASI_Hs01_00198100 predicted 334
14 SASI_Hs01_00198102 predicted 349
15 SASI_Hs01_00198104 predicted 323
16 SASI_Hs01_00198105 predicted 323
17 SASI_Hs01_00198106 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221188 predicted 319
2 SASI_Hs01_00221189 predicted 325
3 SASI_Hs01_00221190 predicted 355
4 SASI_Hs01_00221191 predicted 335
5 SASI_Hs01_00221192 predicted 329
6 SASI_Hs01_00221193 predicted 348
7 SASI_Hs01_00221194 predicted 356
8 SASI_Hs01_00221195 predicted 324
9 SASI_Hs01_00221196 predicted 322
10 SASI_Hs01_00221197 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244394 predicted 1455
2 SASI_Rn02_00244395 predicted 1255
3 SASI_Rn02_00244396 predicted 1439
4 SASI_Rn02_00244397 predicted 1509
5 SASI_Rn02_00244398 predicted 1459
6 SASI_Rn02_00244399 predicted 1510
7 SASI_Rn02_00244400 predicted 1513
8 SASI_Rn02_00244401 predicted 1441
9 SASI_Rn02_00244402 predicted 1444
10 SASI_Rn02_00244403 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142809 predicted 690
2 SASI_Mm01_00142810 predicted 1081
3 SASI_Mm01_00142812 predicted 690
4 SASI_Mm01_00142813 predicted 978
5 SASI_Mm01_00142814 predicted 508
6 SASI_Mm01_00142816 predicted 1111
7 SASI_Mm01_00142817 predicted 772
8 SASI_Mm01_00142818 predicted 1076
9 SASI_Mm02_00316930 predicted 942
10 SASI_Mm02_00316931 predicted 240
11 SASI_Mm01_00142811 predicted 226
12 SASI_Mm01_00142815 predicted 390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001707
VALIDATED
BCL7B MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 7B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001707.2-236s1c1
Sequence:CCGGCACGTCCCTGAGGATATTTAACTCGAGTTAAATATCCTCAGGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_001707.2-324s1c1
Sequence:CCGGCCTAATGGCTTTCCTTCTGATCTCGAGATCAGAAGGAAAGCCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001707.2-482s1c1
Sequence:CCGGCCCAGCACACACCTCCGACTTCTCGAGAAGTCGGAGGTGTGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001707.2-197s1c1
Sequence:CCGGAGTGCGGAAATGGGAGAAGAACTCGAGTTCTTCTCCCATTTCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001707.2-591s1c1
Sequence:CCGGCCTACCCTCACCAAGGAAGAACTCGAGTTCTTCCTTGGTGAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001707.2-591s21c1
Sequence:CCGGCCTACCCTCACCAAGGAAGAACTCGAGTTCTTCCTTGGTGAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001707.2-482s21c1
Sequence:CCGGCCCAGCACACACCTCCGACTTCTCGAGAAGTCGGAGGTGTGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001707.2-324s21c1
Sequence:CCGGCCTAATGGCTTTCCTTCTGATCTCGAGATCAGAAGGAAAGCCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001707.2-236s21c1
Sequence:CCGGCACGTCCCTGAGGATATTTAACTCGAGTTAAATATCCTCAGGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001707.2-746s21c1
Sequence:CCGGTCCTGGCCCTGCCTCTATTTACTCGAGTAAATAGAGGCAGGGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001707
VALIDATED
BCL7B MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 7B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001707.2-236s1c1
Sequence:CCGGCACGTCCCTGAGGATATTTAACTCGAGTTAAATATCCTCAGGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_001707.2-324s1c1
Sequence:CCGGCCTAATGGCTTTCCTTCTGATCTCGAGATCAGAAGGAAAGCCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001707.2-482s1c1
Sequence:CCGGCCCAGCACACACCTCCGACTTCTCGAGAAGTCGGAGGTGTGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001707.2-197s1c1
Sequence:CCGGAGTGCGGAAATGGGAGAAGAACTCGAGTTCTTCTCCCATTTCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001707.2-591s1c1
Sequence:CCGGCCTACCCTCACCAAGGAAGAACTCGAGTTCTTCCTTGGTGAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001707.2-591s21c1
Sequence:CCGGCCTACCCTCACCAAGGAAGAACTCGAGTTCTTCCTTGGTGAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001707.2-482s21c1
Sequence:CCGGCCCAGCACACACCTCCGACTTCTCGAGAAGTCGGAGGTGTGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001707.2-324s21c1
Sequence:CCGGCCTAATGGCTTTCCTTCTGATCTCGAGATCAGAAGGAAAGCCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001707.2-236s21c1
Sequence:CCGGCACGTCCCTGAGGATATTTAACTCGAGTTAAATATCCTCAGGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001707.2-746s21c1
Sequence:CCGGTCCTGGCCCTGCCTCTATTTACTCGAGTAAATAGAGGCAGGGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001707
VALIDATED
BCL7B MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 7B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001707.2-236s1c1
Sequence:CCGGCACGTCCCTGAGGATATTTAACTCGAGTTAAATATCCTCAGGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_001707.2-324s1c1
Sequence:CCGGCCTAATGGCTTTCCTTCTGATCTCGAGATCAGAAGGAAAGCCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001707.2-482s1c1
Sequence:CCGGCCCAGCACACACCTCCGACTTCTCGAGAAGTCGGAGGTGTGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001707.2-197s1c1
Sequence:CCGGAGTGCGGAAATGGGAGAAGAACTCGAGTTCTTCTCCCATTTCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001707.2-591s1c1
Sequence:CCGGCCTACCCTCACCAAGGAAGAACTCGAGTTCTTCCTTGGTGAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001707.2-591s21c1
Sequence:CCGGCCTACCCTCACCAAGGAAGAACTCGAGTTCTTCCTTGGTGAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001707.2-482s21c1
Sequence:CCGGCCCAGCACACACCTCCGACTTCTCGAGAAGTCGGAGGTGTGTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001707.2-324s21c1
Sequence:CCGGCCTAATGGCTTTCCTTCTGATCTCGAGATCAGAAGGAAAGCCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001707.2-236s21c1
Sequence:CCGGCACGTCCCTGAGGATATTTAACTCGAGTTAAATATCCTCAGGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001707.2-746s21c1
Sequence:CCGGTCCTGGCCCTGCCTCTATTTACTCGAGTAAATAGAGGCAGGGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009745
VALIDATED
BCL7B MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 7B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009745.1-463s1c1
Sequence:CCGGCCTGCATCTGAAGTTGCAGATCTCGAGATCTGCAACTTCAGATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009745.1-466s1c1
Sequence:CCGGGCATCTGAAGTTGCAGATGAACTCGAGTTCATCTGCAACTTCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009745.1-141s1c1
Sequence:CCGGCCTGAGGATATTCAAATGGGTCTCGAGACCCATTTGAATATCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009745.1-652s1c1
Sequence:CCGGCCCTGCCTCTATTTATTGCATCTCGAGATGCAATAAATAGAGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-276s21c1
Sequence:CCGGATGGGTGCCTGTGACAGATAGCTCGAGCTATCTGTCACAGGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-253s21c1
Sequence:CCGGGATACCTCCCTGAGGATATTCCTCGAGGAATATCCTCAGGGAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-426s21c1
Sequence:CCGGGTCGGATGTCTATCAACTCAACTCGAGTTGAGTTGATAGACATCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-583s21c1
Sequence:CCGGCCTGCATCTGAAGTTGCAGATCTCGAGATCTGCAACTTCAGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-984s21c1
Sequence:CCGGCCAGAGCATCAGGGTTCATTTCTCGAGAAATGAACCCTGATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009745
VALIDATED
BCL7B MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 7B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009745.1-463s1c1
Sequence:CCGGCCTGCATCTGAAGTTGCAGATCTCGAGATCTGCAACTTCAGATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009745.1-466s1c1
Sequence:CCGGGCATCTGAAGTTGCAGATGAACTCGAGTTCATCTGCAACTTCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009745.1-141s1c1
Sequence:CCGGCCTGAGGATATTCAAATGGGTCTCGAGACCCATTTGAATATCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009745.1-652s1c1
Sequence:CCGGCCCTGCCTCTATTTATTGCATCTCGAGATGCAATAAATAGAGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-276s21c1
Sequence:CCGGATGGGTGCCTGTGACAGATAGCTCGAGCTATCTGTCACAGGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-253s21c1
Sequence:CCGGGATACCTCCCTGAGGATATTCCTCGAGGAATATCCTCAGGGAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-426s21c1
Sequence:CCGGGTCGGATGTCTATCAACTCAACTCGAGTTGAGTTGATAGACATCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-583s21c1
Sequence:CCGGCCTGCATCTGAAGTTGCAGATCTCGAGATCTGCAACTTCAGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-984s21c1
Sequence:CCGGCCAGAGCATCAGGGTTCATTTCTCGAGAAATGAACCCTGATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009745
VALIDATED
BCL7B MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 7B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009745.1-463s1c1
Sequence:CCGGCCTGCATCTGAAGTTGCAGATCTCGAGATCTGCAACTTCAGATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009745.1-466s1c1
Sequence:CCGGGCATCTGAAGTTGCAGATGAACTCGAGTTCATCTGCAACTTCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009745.1-141s1c1
Sequence:CCGGCCTGAGGATATTCAAATGGGTCTCGAGACCCATTTGAATATCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009745.1-652s1c1
Sequence:CCGGCCCTGCCTCTATTTATTGCATCTCGAGATGCAATAAATAGAGGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-276s21c1
Sequence:CCGGATGGGTGCCTGTGACAGATAGCTCGAGCTATCTGTCACAGGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-253s21c1
Sequence:CCGGGATACCTCCCTGAGGATATTCCTCGAGGAATATCCTCAGGGAGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-426s21c1
Sequence:CCGGGTCGGATGTCTATCAACTCAACTCGAGTTGAGTTGATAGACATCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-583s21c1
Sequence:CCGGCCTGCATCTGAAGTTGCAGATCTCGAGATCTGCAACTTCAGATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009745.2-984s21c1
Sequence:CCGGCCAGAGCATCAGGGTTCATTTCTCGAGAAATGAACCCTGATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks