EMAIL THIS PAGE TO A FRIEND

BCL7C

B-cell CLL/lymphoma 7C

75 Gene Product Result for
UniProtKB ID: Q8WUZ0, O43770, Q6PD89
Gene ID:
Human(9274) Summary: This gene is identified by the similarity of its product to the N-terminal region of BCL7A protein. The BCL7A protein is encoded by the gene known to be directly involved in a three-way gene translocation in a Burkitt lymphoma cell line. The function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(12055) B cell CLL/lymphoma 7C
Rat(293514) B-cell CLL/lymphoma 7C
cow(618295) B-cell CLL/lymphoma 7C
domestic cat(101083897) B-cell CLL/lymphoma 7C
dog(479774) B-cell CLL/lymphoma 7C
sheep(101103285) B-cell CLL/lymphoma 7C
naked mole-rat(101703174) B-cell CLL/lymphoma 7C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004765 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU028271 MISSION® esiRNA esiRNA targeting mouse Bcl7c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004765 Rosetta Predictions human pricing
NM_001106298 Rosetta Predictions rat pricing
NM_009746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066888 predicted 389
2 SASI_Hs01_00066889 predicted 380
3 SASI_Hs01_00066890 predicted 424
4 SASI_Hs01_00066891 predicted 387
5 SASI_Hs01_00066892 predicted 426
6 SASI_Hs01_00066893 predicted 397
7 SASI_Hs01_00066894 predicted 388
8 SASI_Hs01_00066895 predicted 380
9 SASI_Hs01_00066897 predicted 494
10 SASI_Hs02_00338263 predicted 556
11 SASI_Hs01_00066896 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217598 predicted 754
2 SASI_Rn02_00217599 predicted 374
3 SASI_Rn02_00217600 predicted 378
4 SASI_Rn02_00217601 predicted 366
5 SASI_Rn02_00217602 predicted 645
6 SASI_Rn02_00217603 predicted 511
7 SASI_Rn02_00217604 predicted 642
8 SASI_Rn02_00217605 predicted 550
9 SASI_Rn02_00217606 predicted 756
10 SASI_Rn02_00217607 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093383 predicted 737
2 SASI_Mm01_00093384 predicted 354
3 SASI_Mm02_00316932 predicted 351
4 SASI_Mm01_00093386 predicted 531
5 SASI_Mm01_00093387 predicted 493
6 SASI_Mm01_00093388 predicted 349
7 SASI_Mm01_00093389 predicted 527
8 SASI_Mm01_00093390 predicted 497
9 SASI_Mm01_00093391 predicted 488
10 SASI_Mm01_00093392 predicted 525
11 SASI_Mm01_00093385 predicted 534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009746
VALIDATED
BCL7C MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 7C
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-311s21c1
Sequence:CCGGCATCGAGAAGGTCCGGAGATGCTCGAGCATCTCCGGACCTTCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-499s21c1
Sequence:CCGGTCATCCTACTGGATCTCAATGCTCGAGCATTGAGATCCAGTAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-540s21c1
Sequence:CCGGTTCCATTCTGAAGGTTCATTGCTCGAGCAATGAACCTTCAGAATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-356s21c1
Sequence:CCGGAGACACTTCCCTTCGAATCTTCTCGAGAAGATTCGAAGGGAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-522s21c1
Sequence:CCGGGAGAACAGCAACCAGAGTTTCCTCGAGGAAACTCTGGTTGCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009746.2-663s1c1
Sequence:CCGGCAATTGGGTCAGGAGAGAGATCTCGAGATCTCTCTCCTGACCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009746.2-542s1c1
Sequence:CCGGCCATTCTGAAGGTTCATTGCACTCGAGTGCAATGAACCTTCAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009746.2-631s1c1
Sequence:CCGGCAGAAGTGATTACTGAAGATACTCGAGTATCTTCAGTAATCACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009746.2-497s1c1
Sequence:CCGGCCTCATCCTACTGGATCTCAACTCGAGTTGAGATCCAGTAGGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009746.2-522s1c1
Sequence:CCGGGAGAACAGCAACCAGAGTTTCCTCGAGGAAACTCTGGTTGCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009746.2-744s1c1
Sequence:CCGGGTTCCAGAATTGCTAGAAGCTCTCGAGAGCTTCTAGCAATTCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009746
VALIDATED
BCL7C MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 7C
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-311s21c1
Sequence:CCGGCATCGAGAAGGTCCGGAGATGCTCGAGCATCTCCGGACCTTCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-499s21c1
Sequence:CCGGTCATCCTACTGGATCTCAATGCTCGAGCATTGAGATCCAGTAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-540s21c1
Sequence:CCGGTTCCATTCTGAAGGTTCATTGCTCGAGCAATGAACCTTCAGAATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-356s21c1
Sequence:CCGGAGACACTTCCCTTCGAATCTTCTCGAGAAGATTCGAAGGGAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-522s21c1
Sequence:CCGGGAGAACAGCAACCAGAGTTTCCTCGAGGAAACTCTGGTTGCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009746.2-663s1c1
Sequence:CCGGCAATTGGGTCAGGAGAGAGATCTCGAGATCTCTCTCCTGACCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009746.2-542s1c1
Sequence:CCGGCCATTCTGAAGGTTCATTGCACTCGAGTGCAATGAACCTTCAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009746.2-631s1c1
Sequence:CCGGCAGAAGTGATTACTGAAGATACTCGAGTATCTTCAGTAATCACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009746.2-497s1c1
Sequence:CCGGCCTCATCCTACTGGATCTCAACTCGAGTTGAGATCCAGTAGGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009746.2-522s1c1
Sequence:CCGGGAGAACAGCAACCAGAGTTTCCTCGAGGAAACTCTGGTTGCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009746.2-744s1c1
Sequence:CCGGGTTCCAGAATTGCTAGAAGCTCTCGAGAGCTTCTAGCAATTCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009746
VALIDATED
BCL7C MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 7C
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-311s21c1
Sequence:CCGGCATCGAGAAGGTCCGGAGATGCTCGAGCATCTCCGGACCTTCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-499s21c1
Sequence:CCGGTCATCCTACTGGATCTCAATGCTCGAGCATTGAGATCCAGTAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-540s21c1
Sequence:CCGGTTCCATTCTGAAGGTTCATTGCTCGAGCAATGAACCTTCAGAATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-356s21c1
Sequence:CCGGAGACACTTCCCTTCGAATCTTCTCGAGAAGATTCGAAGGGAAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009746.2-522s21c1
Sequence:CCGGGAGAACAGCAACCAGAGTTTCCTCGAGGAAACTCTGGTTGCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009746.2-663s1c1
Sequence:CCGGCAATTGGGTCAGGAGAGAGATCTCGAGATCTCTCTCCTGACCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009746.2-542s1c1
Sequence:CCGGCCATTCTGAAGGTTCATTGCACTCGAGTGCAATGAACCTTCAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009746.2-631s1c1
Sequence:CCGGCAGAAGTGATTACTGAAGATACTCGAGTATCTTCAGTAATCACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009746.2-497s1c1
Sequence:CCGGCCTCATCCTACTGGATCTCAACTCGAGTTGAGATCCAGTAGGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009746.2-522s1c1
Sequence:CCGGGAGAACAGCAACCAGAGTTTCCTCGAGGAAACTCTGGTTGCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009746.2-744s1c1
Sequence:CCGGGTTCCAGAATTGCTAGAAGCTCTCGAGAGCTTCTAGCAATTCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004765
BCL7C MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 7C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-393s1c1
Sequence:CCGGCTCATCCTGCTGGATCTTAATCTCGAGATTAAGATCCAGCAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-205s1c1
Sequence:CCGGCCATCGAGAAGGTCCGGAGATCTCGAGATCTCCGGACCTTCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-260s1c1
Sequence:CCGGCCTTCGTATCTTCAAGTGGGTCTCGAGACCCACTTGAAGATACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-666s1c1
Sequence:CCGGCCCGAAGCTTACCCTGTCTTTCTCGAGAAAGACAGGGTAAGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-401s1c1
Sequence:CCGGGCTGGATCTTAATGATGAGAACTCGAGTTCTCATCATTAAGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004765
BCL7C MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 7C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-393s1c1
Sequence:CCGGCTCATCCTGCTGGATCTTAATCTCGAGATTAAGATCCAGCAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-205s1c1
Sequence:CCGGCCATCGAGAAGGTCCGGAGATCTCGAGATCTCCGGACCTTCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-260s1c1
Sequence:CCGGCCTTCGTATCTTCAAGTGGGTCTCGAGACCCACTTGAAGATACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-666s1c1
Sequence:CCGGCCCGAAGCTTACCCTGTCTTTCTCGAGAAAGACAGGGTAAGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-401s1c1
Sequence:CCGGGCTGGATCTTAATGATGAGAACTCGAGTTCTCATCATTAAGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004765
BCL7C MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 7C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-393s1c1
Sequence:CCGGCTCATCCTGCTGGATCTTAATCTCGAGATTAAGATCCAGCAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-205s1c1
Sequence:CCGGCCATCGAGAAGGTCCGGAGATCTCGAGATCTCCGGACCTTCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-260s1c1
Sequence:CCGGCCTTCGTATCTTCAAGTGGGTCTCGAGACCCACTTGAAGATACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-666s1c1
Sequence:CCGGCCCGAAGCTTACCCTGTCTTTCTCGAGAAAGACAGGGTAAGCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004765.2-401s1c1
Sequence:CCGGGCTGGATCTTAATGATGAGAACTCGAGTTCTCATCATTAAGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks