EMAIL THIS PAGE TO A FRIEND

BCL9

B-cell CLL/lymphoma 9

112 Gene Product Result for
Synonyms: LGS
UniProtKB ID: O00512, Q5T489
Gene ID:
Human(607) Summary: BCL9 is associated with B-cell acute lymphoblastic leukemia. It may be a target of translocation in B-cell malignancies with abnormalities of 1q21. Its function is unknown. The overexpression of BCL9 may be of pathogenic significance in B-cell malignancies. [provided by RefSeq, Jul 2008]
Mouse(77578) B cell CLL/lymphoma 9
Rat(310704) B-cell CLL/lymphoma 9
naked mole-rat(101724688) B-cell CLL/lymphoma 9
domestic guinea pig(100728381) B-cell CLL/lymphoma 9
sheep(101114572) B-cell CLL/lymphoma 9
Domestic Rabbit(100338161) B-cell CLL/lymphoma 9
Zebrafish(449616) B-cell CLL/lymphoma 9
cow(788729) B-cell CLL/lymphoma 9
Horse(100065022) B-cell CLL/lymphoma 9
chicken(418456) B-cell CLL/lymphoma 9
dog(483154) B-cell CLL/lymphoma 9
domestic cat(101093037) B-cell CLL/lymphoma 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004326 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022341 MISSION® esiRNA esiRNA human BCL9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004326 Rosetta Predictions human pricing
NM_001107703 Rosetta Predictions rat pricing
NM_029933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102456 predicted 1320
2 SASI_Hs01_00102457 predicted 1648
3 SASI_Hs01_00102458 predicted 3165
4 SASI_Hs01_00102459 predicted 1031
5 SASI_Hs01_00102460 predicted 2909
6 SASI_Hs01_00102461 predicted 4424
7 SASI_Hs01_00102462 predicted 3869
8 SASI_Hs01_00102463 predicted 1837
9 SASI_Hs02_00337364 predicted 2996
10 SASI_Hs02_00337365 predicted 4433
11 SASI_Hs01_00102455 predicted 1072
12 SASI_Hs01_00102464 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231445 predicted 1791
2 SASI_Rn02_00231446 predicted 1730
3 SASI_Rn02_00231447 predicted 1756
4 SASI_Rn02_00231448 predicted 1701
5 SASI_Rn02_00231449 predicted 3023
6 SASI_Rn02_00231450 predicted 2351
7 SASI_Rn02_00231451 predicted 1723
8 SASI_Rn02_00231452 predicted 2460
9 SASI_Rn02_00231453 predicted 3270
10 SASI_Rn02_00231454 predicted 2680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047400 predicted 2560
2 SASI_Mm02_00336215 predicted 468
3 SASI_Mm01_00047401 predicted 750
4 SASI_Mm01_00047402 predicted 2539
5 SASI_Mm01_00047403 predicted 993
6 SASI_Mm01_00047404 predicted 2232
7 SASI_Mm01_00047405 predicted 3829
8 SASI_Mm01_00047406 predicted 720
9 SASI_Mm01_00047407 predicted 441
10 SASI_Mm01_00047409 predicted 3139
11 SASI_Mm01_00047408 predicted 2313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004326
BCL9 MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004326.1-2969s1c1
Sequence:CCGGCCTGAGGAGATGCTGAAATTACTCGAGTAATTTCAGCATCTCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004326.1-1653s1c1
Sequence:CCGGCCAACTCAACTCCCAACAATACTCGAGTATTGTTGGGAGTTGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004326.1-3675s1c1
Sequence:CCGGCCTCTGTGAATATCCCTGGAACTCGAGTTCCAGGGATATTCACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004326.1-2435s1c1
Sequence:CCGGGCAGGCATGATAAACTCTGAACTCGAGTTCAGAGTTTATCATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004326.1-5870s1c1
Sequence:CCGGGCTGCAATACACAGTGTTATTCTCGAGAATAACACTGTGTATTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004326.2-2429s21c1
Sequence:CCGGTGGATTTGCAGGCATGATAAACTCGAGTTTATCATGCCTGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004326.2-3266s21c1
Sequence:CCGGGCGGAAGCCCTTGGATATATCCTCGAGGATATATCCAAGGGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004326.2-4440s21c1
Sequence:CCGGTTTGATCTATCCCGCATTATTCTCGAGAATAATGCGGGATAGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004326
BCL9 MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004326.1-2969s1c1
Sequence:CCGGCCTGAGGAGATGCTGAAATTACTCGAGTAATTTCAGCATCTCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004326.1-1653s1c1
Sequence:CCGGCCAACTCAACTCCCAACAATACTCGAGTATTGTTGGGAGTTGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004326.1-3675s1c1
Sequence:CCGGCCTCTGTGAATATCCCTGGAACTCGAGTTCCAGGGATATTCACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004326.1-2435s1c1
Sequence:CCGGGCAGGCATGATAAACTCTGAACTCGAGTTCAGAGTTTATCATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004326.1-5870s1c1
Sequence:CCGGGCTGCAATACACAGTGTTATTCTCGAGAATAACACTGTGTATTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004326.2-2429s21c1
Sequence:CCGGTGGATTTGCAGGCATGATAAACTCGAGTTTATCATGCCTGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004326.2-3266s21c1
Sequence:CCGGGCGGAAGCCCTTGGATATATCCTCGAGGATATATCCAAGGGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004326.2-4440s21c1
Sequence:CCGGTTTGATCTATCCCGCATTATTCTCGAGAATAATGCGGGATAGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004326
BCL9 MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004326.1-2969s1c1
Sequence:CCGGCCTGAGGAGATGCTGAAATTACTCGAGTAATTTCAGCATCTCCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004326.1-1653s1c1
Sequence:CCGGCCAACTCAACTCCCAACAATACTCGAGTATTGTTGGGAGTTGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004326.1-3675s1c1
Sequence:CCGGCCTCTGTGAATATCCCTGGAACTCGAGTTCCAGGGATATTCACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004326.1-2435s1c1
Sequence:CCGGGCAGGCATGATAAACTCTGAACTCGAGTTCAGAGTTTATCATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004326.1-5870s1c1
Sequence:CCGGGCTGCAATACACAGTGTTATTCTCGAGAATAACACTGTGTATTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004326.2-2429s21c1
Sequence:CCGGTGGATTTGCAGGCATGATAAACTCGAGTTTATCATGCCTGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004326.2-3266s21c1
Sequence:CCGGGCGGAAGCCCTTGGATATATCCTCGAGGATATATCCAAGGGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004326.2-4440s21c1
Sequence:CCGGTTTGATCTATCCCGCATTATTCTCGAGAATAATGCGGGATAGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029933
VALIDATED
BCL9 MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029933.3-4501s1c1
Sequence:CCGGCCTTACTGTTGGTCATGCAATCTCGAGATTGCATGACCAACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029933.3-2530s1c1
Sequence:CCGGGCGCAATCTCAGAGAACCAATCTCGAGATTGGTTCTCTGAGATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029933.3-757s1c1
Sequence:CCGGCCAGAACATCTCTAACAGCAACTCGAGTTGCTGTTAGAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029933.3-3157s1c1
Sequence:CCGGCTCCATTATGATGTCTCGAATCTCGAGATTCGAGACATCATAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029933.3-1365s1c1
Sequence:CCGGCCATGATGTCTCAATCCCAAACTCGAGTTTGGGATTGAGACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029933.3-2665s21c1
Sequence:CCGGGCGGAAGCCTTTGGATATATCCTCGAGGATATATCCAAAGGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029933.3-4443s21c1
Sequence:CCGGATCCTTGTCAAGATGAGATTCCTCGAGGAATCTCATCTTGACAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029933.3-3839s21c1
Sequence:CCGGTTTGATCTCTCCCGCATTATCCTCGAGGATAATGCGGGAGAGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029933.3-682s21c1
Sequence:CCGGTTCTACGGAGATGGCAAATAACTCGAGTTATTTGCCATCTCCGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029933.3-2530s21c1
Sequence:CCGGGCGCAATCTCAGAGAACCAATCTCGAGATTGGTTCTCTGAGATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029933
VALIDATED
BCL9 MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029933.3-4501s1c1
Sequence:CCGGCCTTACTGTTGGTCATGCAATCTCGAGATTGCATGACCAACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029933.3-2530s1c1
Sequence:CCGGGCGCAATCTCAGAGAACCAATCTCGAGATTGGTTCTCTGAGATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029933.3-757s1c1
Sequence:CCGGCCAGAACATCTCTAACAGCAACTCGAGTTGCTGTTAGAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029933.3-3157s1c1
Sequence:CCGGCTCCATTATGATGTCTCGAATCTCGAGATTCGAGACATCATAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029933.3-1365s1c1
Sequence:CCGGCCATGATGTCTCAATCCCAAACTCGAGTTTGGGATTGAGACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029933.3-2665s21c1
Sequence:CCGGGCGGAAGCCTTTGGATATATCCTCGAGGATATATCCAAAGGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029933.3-4443s21c1
Sequence:CCGGATCCTTGTCAAGATGAGATTCCTCGAGGAATCTCATCTTGACAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029933.3-3839s21c1
Sequence:CCGGTTTGATCTCTCCCGCATTATCCTCGAGGATAATGCGGGAGAGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029933.3-682s21c1
Sequence:CCGGTTCTACGGAGATGGCAAATAACTCGAGTTATTTGCCATCTCCGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029933.3-2530s21c1
Sequence:CCGGGCGCAATCTCAGAGAACCAATCTCGAGATTGGTTCTCTGAGATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029933
VALIDATED
BCL9 MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029933.3-4501s1c1
Sequence:CCGGCCTTACTGTTGGTCATGCAATCTCGAGATTGCATGACCAACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029933.3-2530s1c1
Sequence:CCGGGCGCAATCTCAGAGAACCAATCTCGAGATTGGTTCTCTGAGATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029933.3-757s1c1
Sequence:CCGGCCAGAACATCTCTAACAGCAACTCGAGTTGCTGTTAGAGATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029933.3-3157s1c1
Sequence:CCGGCTCCATTATGATGTCTCGAATCTCGAGATTCGAGACATCATAATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029933.3-1365s1c1
Sequence:CCGGCCATGATGTCTCAATCCCAAACTCGAGTTTGGGATTGAGACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029933.3-2665s21c1
Sequence:CCGGGCGGAAGCCTTTGGATATATCCTCGAGGATATATCCAAAGGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029933.3-4443s21c1
Sequence:CCGGATCCTTGTCAAGATGAGATTCCTCGAGGAATCTCATCTTGACAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029933.3-3839s21c1
Sequence:CCGGTTTGATCTCTCCCGCATTATCCTCGAGGATAATGCGGGAGAGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029933.3-682s21c1
Sequence:CCGGTTCTACGGAGATGGCAAATAACTCGAGTTATTTGCCATCTCCGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029933.3-2530s21c1
Sequence:CCGGGCGCAATCTCAGAGAACCAATCTCGAGATTGGTTCTCTGAGATTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks