EMAIL THIS PAGE TO A FRIEND

BCL9L

B-cell CLL/lymphoma 9-like

217 Gene Product Result for
Synonyms: BCL9-2 DLNB11
UniProtKB ID: Q86UU0, A1A4C1, Q67FY1, Q6ZWJ0, Q6ZWK2
Gene ID:
Mouse(80288) B cell CLL/lymphoma 9-like
Rat(300673) B-cell CLL/lymphoma 9-like
Zebrafish(449532) B-cell CLL/lymphoma 9-like
cow(539340) B-cell CLL/lymphoma 9-like
Horse(100063146) B-cell CLL/lymphoma 9-like
domestic cat(101092884) B-cell CLL/lymphoma 9-like
dog(489377) B-cell CLL/lymphoma 9-like
chicken(419785) B-cell CLL/lymphoma 9-like
sheep(101114641) B-cell CLL/lymphoma 9-like
domestic guinea pig(100723467) B-cell CLL/lymphoma 9-like
naked mole-rat(101722822) B-cell CLL/lymphoma 9-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182557 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182557 Rosetta Predictions human pricing
NM_001106817 Rosetta Predictions rat pricing
NM_030256 Rosetta Predictions mouse pricing
XM_901412 Rosetta Predictions mouse pricing
XM_901414 Rosetta Predictions mouse pricing
XM_901417 Rosetta Predictions mouse pricing
XM_901421 Rosetta Predictions mouse pricing
XM_901423 Rosetta Predictions mouse pricing
XM_901427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231410 predicted 3717
2 SASI_Hs01_00231411 predicted 1280
3 SASI_Hs02_00370680 predicted 2916
4 SASI_Hs02_00370681 predicted 2535
5 SASI_Hs02_00370682 predicted 1130
6 SASI_Hs01_00231413 predicted 5236
7 SASI_Hs01_00231414 predicted 1215
8 SASI_Hs01_00231415 predicted 4960
9 SASI_Hs01_00231416 predicted 4929
10 SASI_Hs01_00231418 predicted 2557
11 SASI_Hs01_00231409 predicted 3344
12 SASI_Hs01_00231412 predicted 3443
13 SASI_Hs01_00231417 predicted 3263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222698 predicted 3371
2 SASI_Rn02_00222699 predicted 4905
3 SASI_Rn02_00222700 predicted 2381
4 SASI_Rn02_00222701 predicted 3367
5 SASI_Rn02_00222702 predicted 2193
6 SASI_Rn02_00222703 predicted 2779
7 SASI_Rn02_00222704 predicted 3042
8 SASI_Rn02_00222705 predicted 4040
9 SASI_Rn02_00222706 predicted 1217
10 SASI_Rn02_00222707 predicted 2476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123723 predicted 2032
2 SASI_Mm02_00336728 predicted 4474
3 SASI_Mm01_00123724 predicted 2947
4 SASI_Mm01_00123725 predicted 4029
5 SASI_Mm01_00123726 predicted 1797
6 SASI_Mm01_00123727 predicted 3608
7 SASI_Mm01_00123728 predicted 460
8 SASI_Mm01_00123729 predicted 2045
9 SASI_Mm01_00123730 predicted 3506
10 SASI_Mm01_00123731 predicted 522
11 SASI_Mm01_00123732 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266195 predicted 3220
2 SASI_Mm01_00266196 predicted 4302
3 SASI_Mm01_00266197 predicted 3880
4 SASI_Mm01_00266198 predicted 739
5 SASI_Mm01_00266199 predicted 2971
6 SASI_Mm01_00266200 predicted 2600
7 SASI_Mm01_00266201 predicted 901
8 SASI_Mm01_00266202 predicted 3774
9 SASI_Mm01_00266203 predicted 2878
10 SASI_Mm01_00266204 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257868 predicted 3064
2 SASI_Mm01_00257869 predicted 716
3 SASI_Mm01_00257870 predicted 4277
4 SASI_Mm01_00257871 predicted 3748
5 SASI_Mm01_00257872 predicted 725
6 SASI_Mm01_00257873 predicted 1805
7 SASI_Mm01_00257874 predicted 3431
8 SASI_Mm01_00257875 predicted 3640
9 SASI_Mm01_00257876 predicted 3557
10 SASI_Mm01_00257877 predicted 3729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277836 predicted 2994
2 SASI_Mm01_00277837 predicted 634
3 SASI_Mm01_00277838 predicted 4197
4 SASI_Mm01_00277839 predicted 3671
5 SASI_Mm01_00277840 predicted 640
6 SASI_Mm01_00277841 predicted 1724
7 SASI_Mm01_00277842 predicted 3359
8 SASI_Mm01_00277843 predicted 3564
9 SASI_Mm01_00277844 predicted 3485
10 SASI_Mm01_00277845 predicted 3651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261827 predicted 4287
2 SASI_Mm01_00261828 predicted 4292
3 SASI_Mm01_00261829 predicted 4170
4 SASI_Mm01_00261830 predicted 4291
5 SASI_Mm01_00261831 predicted 4339
6 SASI_Mm01_00261832 predicted 4138
7 SASI_Mm01_00261833 predicted 4341
8 SASI_Mm01_00261834 predicted 4284
9 SASI_Mm01_00261835 predicted 4189
10 SASI_Mm01_00261836 predicted 4299
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210297 predicted 2911
2 SASI_Mm01_00210298 predicted 561
3 SASI_Mm01_00210299 predicted 4116
4 SASI_Mm01_00210300 predicted 3584
5 SASI_Mm01_00210301 predicted 570
6 SASI_Mm01_00210302 predicted 1649
7 SASI_Mm01_00210303 predicted 3282
8 SASI_Mm01_00210304 predicted 3481
9 SASI_Mm01_00210305 predicted 3408
10 SASI_Mm01_00210306 predicted 3576
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238897 predicted 2946
2 SASI_Mm01_00238898 predicted 602
3 SASI_Mm01_00238899 predicted 4157
4 SASI_Mm01_00238900 predicted 3626
5 SASI_Mm01_00238901 predicted 609
6 SASI_Mm01_00238902 predicted 1690
7 SASI_Mm01_00238903 predicted 3321
8 SASI_Mm01_00238904 predicted 3522
9 SASI_Mm01_00238905 predicted 3439
10 SASI_Mm01_00238906 predicted 3623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182557
BCL9L MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 9-like
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182557.2-5492s21c1
Sequence:CCGGGCAATGTTGCAAATACGATAACTCGAGTTATCGTATTTGCAACATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-1488s1c1
Sequence:CCGGGCCACCCACAATTGTAATGTACTCGAGTACATTACAATTGTGGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-5036s1c1
Sequence:CCGGGCATCTCATGAACCTGCAGAACTCGAGTTCTGCAGGTTCATGAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-3551s1c1
Sequence:CCGGCATGGGCAATACCCAAGACATCTCGAGATGTCTTGGGTATTGCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-5251s1c1
Sequence:CCGGCCCAGCAGAATTTCATGCTGACTCGAGTCAGCATGAAATTCTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-1229s1c1
Sequence:CCGGGCCTAGCAACTCAAGTCTGAACTCGAGTTCAGACTTGAGTTGCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182557
BCL9L MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 9-like
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182557.2-5492s21c1
Sequence:CCGGGCAATGTTGCAAATACGATAACTCGAGTTATCGTATTTGCAACATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-1488s1c1
Sequence:CCGGGCCACCCACAATTGTAATGTACTCGAGTACATTACAATTGTGGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-5036s1c1
Sequence:CCGGGCATCTCATGAACCTGCAGAACTCGAGTTCTGCAGGTTCATGAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-3551s1c1
Sequence:CCGGCATGGGCAATACCCAAGACATCTCGAGATGTCTTGGGTATTGCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-5251s1c1
Sequence:CCGGCCCAGCAGAATTTCATGCTGACTCGAGTCAGCATGAAATTCTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-1229s1c1
Sequence:CCGGGCCTAGCAACTCAAGTCTGAACTCGAGTTCAGACTTGAGTTGCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182557
BCL9L MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 9-like
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182557.2-5492s21c1
Sequence:CCGGGCAATGTTGCAAATACGATAACTCGAGTTATCGTATTTGCAACATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-1488s1c1
Sequence:CCGGGCCACCCACAATTGTAATGTACTCGAGTACATTACAATTGTGGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-5036s1c1
Sequence:CCGGGCATCTCATGAACCTGCAGAACTCGAGTTCTGCAGGTTCATGAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-3551s1c1
Sequence:CCGGCATGGGCAATACCCAAGACATCTCGAGATGTCTTGGGTATTGCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-5251s1c1
Sequence:CCGGCCCAGCAGAATTTCATGCTGACTCGAGTCAGCATGAAATTCTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182557.1-1229s1c1
Sequence:CCGGGCCTAGCAACTCAAGTCTGAACTCGAGTTCAGACTTGAGTTGCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030256
VALIDATED
BCL9L MISSION shRNA Bacterial Glycerol Stock
B-cell CLL/lymphoma 9-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000277505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030256.2-912s21c1
Sequence:CCGGCTCCGTCACAGTTCGTCTATGCTCGAGCATAGACGAACTGTGACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030256.2-2027s21c1
Sequence:CCGGATGCAAAGGGTGCCCGGATTTCTCGAGAAATCCGGGCACCCTTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030256.2-4901s21c1
Sequence:CCGGGAATCGGGCTCTGCTCCATTTCTCGAGAAATGGAGCAGAGCCCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030256.2-4158s21c1
Sequence:CCGGGCATTCCTGAGTTCGACTTATCTCGAGATAAGTCGAACTCAGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030256.2-4274s21c1
Sequence:CCGGCTCATGAACCTGCAGAACATGCTCGAGCATGTTCTGCAGGTTCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030256.1-1191s1c1
Sequence:CCGGGCTTCTGTCTCCCTTTGTCTTCTCGAGAAGACAAAGGGAGACAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030256.1-494s1c1
Sequence:CCGGCTCATGAACCTGCAGAACATGCTCGAGCATGTTCTGCAGGTTCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030256.1-1366s1c1
Sequence:CCGGGCCTCATTTCCTTTCCCTACTCTCGAGAGTAGGGAAAGGAAATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030256.1-378s1c1
Sequence:CCGGGCATTCCTGAGTTCGACTTATCTCGAGATAAGTCGAACTCAGGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030256
VALIDATED
BCL9L MISSION shRNA shRNA Plasmid DNA
B-cell CLL/lymphoma 9-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000277505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030256.2-912s21c1
Sequence:CCGGCTCCGTCACAGTTCGTCTATGCTCGAGCATAGACGAACTGTGACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030256.2-2027s21c1
Sequence:CCGGATGCAAAGGGTGCCCGGATTTCTCGAGAAATCCGGGCACCCTTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030256.2-4901s21c1
Sequence:CCGGGAATCGGGCTCTGCTCCATTTCTCGAGAAATGGAGCAGAGCCCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030256.2-4158s21c1
Sequence:CCGGGCATTCCTGAGTTCGACTTATCTCGAGATAAGTCGAACTCAGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030256.2-4274s21c1
Sequence:CCGGCTCATGAACCTGCAGAACATGCTCGAGCATGTTCTGCAGGTTCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030256.1-1191s1c1
Sequence:CCGGGCTTCTGTCTCCCTTTGTCTTCTCGAGAAGACAAAGGGAGACAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030256.1-494s1c1
Sequence:CCGGCTCATGAACCTGCAGAACATGCTCGAGCATGTTCTGCAGGTTCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030256.1-1366s1c1
Sequence:CCGGGCCTCATTTCCTTTCCCTACTCTCGAGAGTAGGGAAAGGAAATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030256.1-378s1c1
Sequence:CCGGGCATTCCTGAGTTCGACTTATCTCGAGATAAGTCGAACTCAGGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030256
VALIDATED
BCL9L MISSION shRNA Lentiviral Transduction Particles
B-cell CLL/lymphoma 9-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000277505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030256.2-912s21c1
Sequence:CCGGCTCCGTCACAGTTCGTCTATGCTCGAGCATAGACGAACTGTGACGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030256.2-2027s21c1
Sequence:CCGGATGCAAAGGGTGCCCGGATTTCTCGAGAAATCCGGGCACCCTTTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030256.2-4901s21c1
Sequence:CCGGGAATCGGGCTCTGCTCCATTTCTCGAGAAATGGAGCAGAGCCCGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030256.2-4158s21c1
Sequence:CCGGGCATTCCTGAGTTCGACTTATCTCGAGATAAGTCGAACTCAGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030256.2-4274s21c1
Sequence:CCGGCTCATGAACCTGCAGAACATGCTCGAGCATGTTCTGCAGGTTCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030256.1-1191s1c1
Sequence:CCGGGCTTCTGTCTCCCTTTGTCTTCTCGAGAAGACAAAGGGAGACAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030256.1-494s1c1
Sequence:CCGGCTCATGAACCTGCAGAACATGCTCGAGCATGTTCTGCAGGTTCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030256.1-1366s1c1
Sequence:CCGGGCCTCATTTCCTTTCCCTACTCTCGAGAGTAGGGAAAGGAAATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030256.1-378s1c1
Sequence:CCGGGCATTCCTGAGTTCGACTTATCTCGAGATAAGTCGAACTCAGGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)