EMAIL THIS PAGE TO A FRIEND

BCLAF1

BCL2-associated transcription factor 1

193 Gene Product Result for
Synonyms: BTF bK211L9.1
Gene ID:
Human(9774) Summary: This gene encodes a transcriptional repressor that interacts with several members of the BCL2 family of proteins. Overexpression of this protein induces apoptosis, which can be suppressed by co-expression of BCL2 proteins. The protein localizes to dot-like structures throughout the nucleus, and redistributes to a zone near the nuclear envelope in cells undergoing apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(72567) BCL2-associated transcription factor 1
Rat(293017) BCL2-associated transcription factor 1
naked mole-rat(101713953) BCL2-associated transcription factor 1
domestic guinea pig(100722154) BCL2-associated transcription factor 1
sheep(101111718) BCL2-associated transcription factor 1
chicken(100858086) BCL2-associated transcription factor 1
dog(483999) BCL2-associated transcription factor 1
domestic cat(101082408) BCL2-associated transcription factor 1
cow(540648) BCL2-associated transcription factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153787 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153787 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153787 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_376537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376537 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001077440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077440 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077440 Rosetta Predictions human pricing
NM_001077441 Rosetta Predictions human pricing
NM_014739 Rosetta Predictions human pricing
NM_001047852 Rosetta Predictions rat pricing
NM_001025392 Rosetta Predictions mouse pricing
NM_001025393 Rosetta Predictions mouse pricing
NM_153787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312544 predicted 1986
2 SASI_Hs02_00312545 predicted 839
3 SASI_Hs02_00312546 predicted 983
4 SASI_Hs02_00312547 predicted 2065
5 SASI_Hs02_00312548 predicted 827
6 SASI_Hs02_00312549 predicted 2159
7 SASI_Hs02_00312550 predicted 689
8 SASI_Hs02_00312551 predicted 2109
9 SASI_Hs02_00312552 predicted 624
10 SASI_Hs02_00312553 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312554 predicted 1475
2 SASI_Hs02_00312555 predicted 846
3 SASI_Hs02_00312556 predicted 991
4 SASI_Hs02_00312557 predicted 1555
5 SASI_Hs02_00312558 predicted 832
6 SASI_Hs02_00312559 predicted 1640
7 SASI_Hs02_00312560 predicted 699
8 SASI_Hs02_00312561 predicted 1598
9 SASI_Hs02_00312562 predicted 629
10 SASI_Hs02_00312563 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346191 predicted 1993
2 SASI_Hs02_00346192 predicted 846
3 SASI_Hs02_00346193 predicted 989
4 SASI_Hs01_00064784 predicted 2070
5 SASI_Hs02_00346194 predicted 836
6 SASI_Hs02_00346195 predicted 2162
7 SASI_Hs02_00346196 predicted 701
8 SASI_Hs02_00346197 predicted 2122
9 SASI_Hs02_00346198 predicted 630
10 SASI_Hs02_00346199 predicted 941
11 SASI_Hs01_00064780 predicted 303
12 SASI_Hs01_00064781 predicted 1561
13 SASI_Hs01_00064782 predicted 1398
14 SASI_Hs01_00064783 predicted 1583
15 SASI_Hs01_00064785 predicted 511
16 SASI_Hs01_00064786 predicted 1246
17 SASI_Hs01_00064787 predicted 1277
18 SASI_Hs01_00064788 predicted 1116
19 SASI_Hs01_00064789 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206195 predicted 319
2 SASI_Rn02_00206196 predicted 2228
3 SASI_Rn02_00206197 predicted 1442
4 SASI_Rn02_00206198 predicted 808
5 SASI_Rn02_00206199 predicted 1497
6 SASI_Rn02_00206200 predicted 1246
7 SASI_Rn02_00206201 predicted 2047
8 SASI_Rn02_00206202 predicted 1935
9 SASI_Rn02_00206203 predicted 401
10 SASI_Rn02_00206204 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100868 predicted 1093
2 SASI_Mm01_00100869 predicted 1456
3 SASI_Mm02_00287865 predicted 1370
4 SASI_Mm01_00100870 predicted 820
5 SASI_Mm01_00100871 predicted 1507
6 SASI_Mm01_00100872 predicted 1308
7 SASI_Mm01_00100873 predicted 1138
8 SASI_Mm01_00100876 predicted 1254
9 SASI_Mm01_00100877 predicted 2292
10 SASI_Mm02_00287866 predicted 1469
11 SASI_Mm01_00100874 predicted 1397
12 SASI_Mm01_00100875 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050013 predicted 1084
2 SASI_Mm01_00050014 predicted 1456
3 SASI_Mm02_00287867 predicted 1374
4 SASI_Mm01_00050015 predicted 818
5 SASI_Mm01_00050016 predicted 1505
6 SASI_Mm01_00050017 predicted 1304
7 SASI_Mm01_00050018 predicted 1135
8 SASI_Mm01_00050021 predicted 1258
9 SASI_Mm01_00050022 predicted 2289
10 SASI_Mm02_00287868 predicted 1463
11 SASI_Mm01_00050019 predicted 1399
12 SASI_Mm01_00050020 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172202 predicted 1086
2 SASI_Mm01_00172203 predicted 1451
3 SASI_Mm02_00343510 predicted 1367
4 SASI_Mm01_00172204 predicted 818
5 SASI_Mm01_00172205 predicted 1499
6 SASI_Mm01_00172206 predicted 1295
7 SASI_Mm01_00172207 predicted 1124
8 SASI_Mm01_00172210 predicted 1251
9 SASI_Mm01_00172211 predicted 2291
10 SASI_Mm02_00343511 predicted 1463
11 SASI_Mm01_00172208 predicted 1397
12 SASI_Mm01_00172209 predicted 855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153787
VALIDATED
BCLAF1 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated transcription factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153787.1-565s1c1
Sequence:CCGGGCCGGTCATATAGATCCTCTACTCGAGTAGAGGATCTATATGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153787.1-2060s1c1
Sequence:CCGGGCGGTTCACTTCATACCAGAACTCGAGTTCTGGTATGAAGTGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153787.1-2957s1c1
Sequence:CCGGGCAGAACTTGACACTTACATTCTCGAGAATGTAAGTGTCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153787.1-2268s1c1
Sequence:CCGGCGCCGTAAAGAGAGAAGTAAACTCGAGTTTACTTCTCTCTTTACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153787.1-1476s1c1
Sequence:CCGGCCCAAGTACAAGTCCAAAGTTCTCGAGAACTTTGGACTTGTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153787.2-633s21c1
Sequence:CCGGGCCGGTCATATAGATCCTCTACTCGAGTAGAGGATCTATATGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153787.2-3025s21c1
Sequence:CCGGGCAGAACTTGACACTTACATTCTCGAGAATGTAAGTGTCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153787.2-2336s21c1
Sequence:CCGGCGCCGTAAAGAGAGAAGTAAACTCGAGTTTACTTCTCTCTTTACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153787.2-1544s21c1
Sequence:CCGGCCCAAGTACAAGTCCAAAGTTCTCGAGAACTTTGGACTTGTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153787.2-2128s21c1
Sequence:CCGGGCGGTTCACTTCATACCAGAACTCGAGTTCTGGTATGAAGTGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153787
VALIDATED
BCLAF1 MISSION shRNA shRNA Plasmid DNA
BCL2-associated transcription factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153787.1-565s1c1
Sequence:CCGGGCCGGTCATATAGATCCTCTACTCGAGTAGAGGATCTATATGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153787.1-2060s1c1
Sequence:CCGGGCGGTTCACTTCATACCAGAACTCGAGTTCTGGTATGAAGTGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153787.1-2957s1c1
Sequence:CCGGGCAGAACTTGACACTTACATTCTCGAGAATGTAAGTGTCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153787.1-2268s1c1
Sequence:CCGGCGCCGTAAAGAGAGAAGTAAACTCGAGTTTACTTCTCTCTTTACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153787.1-1476s1c1
Sequence:CCGGCCCAAGTACAAGTCCAAAGTTCTCGAGAACTTTGGACTTGTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153787.2-633s21c1
Sequence:CCGGGCCGGTCATATAGATCCTCTACTCGAGTAGAGGATCTATATGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153787.2-3025s21c1
Sequence:CCGGGCAGAACTTGACACTTACATTCTCGAGAATGTAAGTGTCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153787.2-2336s21c1
Sequence:CCGGCGCCGTAAAGAGAGAAGTAAACTCGAGTTTACTTCTCTCTTTACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153787.2-1544s21c1
Sequence:CCGGCCCAAGTACAAGTCCAAAGTTCTCGAGAACTTTGGACTTGTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153787.2-2128s21c1
Sequence:CCGGGCGGTTCACTTCATACCAGAACTCGAGTTCTGGTATGAAGTGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153787
VALIDATED
BCLAF1 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated transcription factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153787.1-565s1c1
Sequence:CCGGGCCGGTCATATAGATCCTCTACTCGAGTAGAGGATCTATATGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153787.1-2060s1c1
Sequence:CCGGGCGGTTCACTTCATACCAGAACTCGAGTTCTGGTATGAAGTGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153787.1-2957s1c1
Sequence:CCGGGCAGAACTTGACACTTACATTCTCGAGAATGTAAGTGTCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153787.1-2268s1c1
Sequence:CCGGCGCCGTAAAGAGAGAAGTAAACTCGAGTTTACTTCTCTCTTTACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153787.1-1476s1c1
Sequence:CCGGCCCAAGTACAAGTCCAAAGTTCTCGAGAACTTTGGACTTGTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153787.2-633s21c1
Sequence:CCGGGCCGGTCATATAGATCCTCTACTCGAGTAGAGGATCTATATGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153787.2-3025s21c1
Sequence:CCGGGCAGAACTTGACACTTACATTCTCGAGAATGTAAGTGTCAAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153787.2-2336s21c1
Sequence:CCGGCGCCGTAAAGAGAGAAGTAAACTCGAGTTTACTTCTCTCTTTACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153787.2-1544s21c1
Sequence:CCGGCCCAAGTACAAGTCCAAAGTTCTCGAGAACTTTGGACTTGTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153787.2-2128s21c1
Sequence:CCGGGCGGTTCACTTCATACCAGAACTCGAGTTCTGGTATGAAGTGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376537
VALIDATED
BCLAF1 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated transcription factor 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376537.1-2143s1c1
Sequence:CCGGGCGGTTCACTTCGTATCAGAACTCGAGTTCTGATACGAAGTGAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376537.1-1109s1c1
Sequence:CCGGCCTTCTCAGAATAGTCCAATTCTCGAGAATTGGACTATTCTGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376537.1-392s1c1
Sequence:CCGGCGTAGTAGAGATCGTATGTATCTCGAGATACATACGATCTCTACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376537.1-642s1c1
Sequence:CCGGGCCGGTCATATAGATCTTCTACTCGAGTAGAAGATCTATATGACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376537.1-1742s1c1
Sequence:CCGGCCTGAGCAGGTAAAGTCTGAACTCGAGTTCAGACTTTACCTGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376537
VALIDATED
BCLAF1 MISSION shRNA shRNA Plasmid DNA
BCL2-associated transcription factor 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376537.1-2143s1c1
Sequence:CCGGGCGGTTCACTTCGTATCAGAACTCGAGTTCTGATACGAAGTGAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376537.1-1109s1c1
Sequence:CCGGCCTTCTCAGAATAGTCCAATTCTCGAGAATTGGACTATTCTGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376537.1-392s1c1
Sequence:CCGGCGTAGTAGAGATCGTATGTATCTCGAGATACATACGATCTCTACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376537.1-642s1c1
Sequence:CCGGGCCGGTCATATAGATCTTCTACTCGAGTAGAAGATCTATATGACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376537.1-1742s1c1
Sequence:CCGGCCTGAGCAGGTAAAGTCTGAACTCGAGTTCAGACTTTACCTGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376537
VALIDATED
BCLAF1 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated transcription factor 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376537.1-2143s1c1
Sequence:CCGGGCGGTTCACTTCGTATCAGAACTCGAGTTCTGATACGAAGTGAACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376537.1-1109s1c1
Sequence:CCGGCCTTCTCAGAATAGTCCAATTCTCGAGAATTGGACTATTCTGAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376537.1-392s1c1
Sequence:CCGGCGTAGTAGAGATCGTATGTATCTCGAGATACATACGATCTCTACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376537.1-642s1c1
Sequence:CCGGGCCGGTCATATAGATCTTCTACTCGAGTAGAAGATCTATATGACCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_376537.1-1742s1c1
Sequence:CCGGCCTGAGCAGGTAAAGTCTGAACTCGAGTTCAGACTTTACCTGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077440
VALIDATED
BCLAF1 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated transcription factor 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-1736s21c1
Sequence:CCGGCCTGAGCAGGTAAAGTCTGAACTCGAGTTCAGACTTTACCTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-2137s21c1
Sequence:CCGGGCGGTTCACTTCGTATCAGAACTCGAGTTCTGATACGAAGTGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-636s21c1
Sequence:CCGGGCCGGTCATATAGATCTTCTACTCGAGTAGAAGATCTATATGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-1103s21c1
Sequence:CCGGCCTTCTCAGAATAGTCCAATTCTCGAGAATTGGACTATTCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336707    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-2966s21c1
Sequence:CCGGACTGTTTGCAAGTAGTCTATACTCGAGTATAGACTACTTGCAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077440
VALIDATED
BCLAF1 MISSION shRNA shRNA Plasmid DNA
BCL2-associated transcription factor 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-1736s21c1
Sequence:CCGGCCTGAGCAGGTAAAGTCTGAACTCGAGTTCAGACTTTACCTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-2137s21c1
Sequence:CCGGGCGGTTCACTTCGTATCAGAACTCGAGTTCTGATACGAAGTGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-636s21c1
Sequence:CCGGGCCGGTCATATAGATCTTCTACTCGAGTAGAAGATCTATATGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-1103s21c1
Sequence:CCGGCCTTCTCAGAATAGTCCAATTCTCGAGAATTGGACTATTCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336707    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-2966s21c1
Sequence:CCGGACTGTTTGCAAGTAGTCTATACTCGAGTATAGACTACTTGCAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077440
VALIDATED
BCLAF1 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated transcription factor 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-1736s21c1
Sequence:CCGGCCTGAGCAGGTAAAGTCTGAACTCGAGTTCAGACTTTACCTGCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-2137s21c1
Sequence:CCGGGCGGTTCACTTCGTATCAGAACTCGAGTTCTGATACGAAGTGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-636s21c1
Sequence:CCGGGCCGGTCATATAGATCTTCTACTCGAGTAGAAGATCTATATGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-1103s21c1
Sequence:CCGGCCTTCTCAGAATAGTCCAATTCTCGAGAATTGGACTATTCTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336707    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001077440.1-2966s21c1
Sequence:CCGGACTGTTTGCAAGTAGTCTATACTCGAGTATAGACTACTTGCAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks