EMAIL THIS PAGE TO A FRIEND

BCMO1

beta-carotene 15,15'-monooxygenase 1

47 Gene Product Result for
Synonyms: BCDO BCDO1 BCMO BCO BCO1
UniProtKB ID: Q9HAY6, A0AV48, A0AV50, Q9NVH5
Gene ID:
Human(53630) Summary: Vitamin A metabolism is important for vital processes such as vision, embryonic development, cell differentiation, and membrane and skin protection. The protein encoded by this gene is a key enzyme in beta-carotene metabolism to vitamin A. It catalyzes the oxidative cleavage of beta,beta-carotene into two retinal molecules. [provided by RefSeq, Jul 2008]
Mouse(63857) beta-carotene 15,15'-monooxygenase
Rat(114106) beta-carotene 15,15'-monooxygenase 1
chicken(395346) beta-carotene 15,15'-monooxygenase 1
cow(534696) beta-carotene 15,15'-monooxygenase 1
Horse(100069873) beta-carotene 15,15'-monooxygenase 1
domestic cat(101101606) beta-carotene 15,15'-monooxygenase 1
dog(489695) beta-carotene 15,15'-monooxygenase 1
naked mole-rat(101724039) beta-carotene 15,15'-monooxygenase 1
domestic guinea pig(100729027) beta-carotene 15,15'-monooxygenase 1
Goat(100861295) beta-carotene 15,15'-monooxygenase 1
sheep(101121875) beta-carotene 15,15'-monooxygenase 1
sheep(100294509) beta-carotene 15,15'-monooxygenase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017429 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021486 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021486 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021486 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011061 MISSION® esiRNA esiRNA targeting human BCMO1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017429 Rosetta Predictions human pricing
NM_053648 Rosetta Predictions rat pricing
NM_021486 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024839 predicted 1471
2 SASI_Hs01_00024840 predicted 691
3 SASI_Hs02_00350001 predicted 1314
4 SASI_Hs01_00024841 predicted 450
5 SASI_Hs01_00024842 predicted 1436
6 SASI_Hs01_00024843 predicted 1462
7 SASI_Hs01_00024844 predicted 1452
8 SASI_Hs01_00024845 predicted 423
9 SASI_Hs01_00024846 predicted 473
10 SASI_Hs01_00024847 predicted 436
11 SASI_Hs01_00024848 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045290 predicted 1604
2 SASI_Rn01_00045291 predicted 239
3 SASI_Rn01_00045292 predicted 803
4 SASI_Rn01_00045293 predicted 465
5 SASI_Rn01_00045294 predicted 942
6 SASI_Rn02_00266371 predicted 1517
7 SASI_Rn01_00045295 predicted 881
8 SASI_Rn01_00045296 predicted 320
9 SASI_Rn01_00045297 predicted 351
10 SASI_Rn01_00045299 predicted 362
11 SASI_Rn01_00045298 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112534 predicted 1393
2 SASI_Mm01_00112535 predicted 1014
3 SASI_Mm01_00112536 predicted 309
4 SASI_Mm01_00112537 predicted 549
5 SASI_Mm01_00112538 predicted 1334
6 SASI_Mm01_00112539 predicted 536
7 SASI_Mm01_00112540 predicted 1468
8 SASI_Mm01_00112541 predicted 369
9 SASI_Mm01_00112542 predicted 384
10 SASI_Mm01_00112543 predicted 949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017429
BCMO1 MISSION shRNA Bacterial Glycerol Stock
beta-carotene 15,15'-monooxygenase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017429.2-405s21c1
Sequence:CCGGAGAGACGGTGAAGTCTATTACCTCGAGGTAATAGACTTCACCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017429.2-2185s21c1
Sequence:CCGGGAACGAGCCACTAACCTATTACTCGAGTAATAGGTTAGTGGCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017429.2-970s21c1
Sequence:CCGGAGCCTTTCAGGTTGGATATTCCTCGAGGAATATCCAACCTGAAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017429.2-1749s21c1
Sequence:CCGGATGGATCTCCATGGATTATTCCTCGAGGAATAATCCATGGAGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-699s1c1
Sequence:CCGGCGTAAATACGTGGCGGTAAATCTCGAGATTTACCGCCACGTATTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-446s1c1
Sequence:CCGGCGATACCTACAACACCAATATCTCGAGATATTGGTGTTGTAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-1631s1c1
Sequence:CCGGCGGAGTAATCTTATCAGCCATCTCGAGATGGCTGATAAGATTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-915s1c1
Sequence:CCGGCCAAGCTACTACCACAGCTTTCTCGAGAAAGCTGTGGTAGTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-1440s1c1
Sequence:CCGGCGGGTCAATTATGCTCACAATCTCGAGATTGTGAGCATAATTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017429
BCMO1 MISSION shRNA shRNA Plasmid DNA
beta-carotene 15,15'-monooxygenase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017429.2-405s21c1
Sequence:CCGGAGAGACGGTGAAGTCTATTACCTCGAGGTAATAGACTTCACCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017429.2-2185s21c1
Sequence:CCGGGAACGAGCCACTAACCTATTACTCGAGTAATAGGTTAGTGGCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017429.2-970s21c1
Sequence:CCGGAGCCTTTCAGGTTGGATATTCCTCGAGGAATATCCAACCTGAAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017429.2-1749s21c1
Sequence:CCGGATGGATCTCCATGGATTATTCCTCGAGGAATAATCCATGGAGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-699s1c1
Sequence:CCGGCGTAAATACGTGGCGGTAAATCTCGAGATTTACCGCCACGTATTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-446s1c1
Sequence:CCGGCGATACCTACAACACCAATATCTCGAGATATTGGTGTTGTAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-1631s1c1
Sequence:CCGGCGGAGTAATCTTATCAGCCATCTCGAGATGGCTGATAAGATTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-915s1c1
Sequence:CCGGCCAAGCTACTACCACAGCTTTCTCGAGAAAGCTGTGGTAGTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-1440s1c1
Sequence:CCGGCGGGTCAATTATGCTCACAATCTCGAGATTGTGAGCATAATTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017429
BCMO1 MISSION shRNA Lentiviral Transduction Particles
beta-carotene 15,15'-monooxygenase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017429.2-405s21c1
Sequence:CCGGAGAGACGGTGAAGTCTATTACCTCGAGGTAATAGACTTCACCGTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017429.2-2185s21c1
Sequence:CCGGGAACGAGCCACTAACCTATTACTCGAGTAATAGGTTAGTGGCTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017429.2-970s21c1
Sequence:CCGGAGCCTTTCAGGTTGGATATTCCTCGAGGAATATCCAACCTGAAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017429.2-1749s21c1
Sequence:CCGGATGGATCTCCATGGATTATTCCTCGAGGAATAATCCATGGAGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-699s1c1
Sequence:CCGGCGTAAATACGTGGCGGTAAATCTCGAGATTTACCGCCACGTATTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-446s1c1
Sequence:CCGGCGATACCTACAACACCAATATCTCGAGATATTGGTGTTGTAGGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-1631s1c1
Sequence:CCGGCGGAGTAATCTTATCAGCCATCTCGAGATGGCTGATAAGATTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-915s1c1
Sequence:CCGGCCAAGCTACTACCACAGCTTTCTCGAGAAAGCTGTGGTAGTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017429.1-1440s1c1
Sequence:CCGGCGGGTCAATTATGCTCACAATCTCGAGATTGTGAGCATAATTGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021486
BCMO1 MISSION shRNA Bacterial Glycerol Stock
beta-carotene 15,15'-monooxygenase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021486.2-1952s1c1
Sequence:CCGGCAGAGAAATCCTATCTTGAAACTCGAGTTTCAAGATAGGATTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021486.2-1472s1c1
Sequence:CCGGCCAACCAAGATACTGAAATATCTCGAGATATTTCAGTATCTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021486.2-1423s1c1
Sequence:CCGGGAAGCCATATCGCTACATCTTCTCGAGAAGATGTAGCGATATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021486.2-596s1c1
Sequence:CCGGGAGACCAACTACATCAGGAAACTCGAGTTTCCTGATGTAGTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021486.2-1396s1c1
Sequence:CCGGCCCTCGGATAAATTATGCTTACTCGAGTAAGCATAATTTATCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021486
BCMO1 MISSION shRNA shRNA Plasmid DNA
beta-carotene 15,15'-monooxygenase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021486.2-1952s1c1
Sequence:CCGGCAGAGAAATCCTATCTTGAAACTCGAGTTTCAAGATAGGATTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021486.2-1472s1c1
Sequence:CCGGCCAACCAAGATACTGAAATATCTCGAGATATTTCAGTATCTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021486.2-1423s1c1
Sequence:CCGGGAAGCCATATCGCTACATCTTCTCGAGAAGATGTAGCGATATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021486.2-596s1c1
Sequence:CCGGGAGACCAACTACATCAGGAAACTCGAGTTTCCTGATGTAGTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021486.2-1396s1c1
Sequence:CCGGCCCTCGGATAAATTATGCTTACTCGAGTAAGCATAATTTATCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021486
BCMO1 MISSION shRNA Lentiviral Transduction Particles
beta-carotene 15,15'-monooxygenase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021486.2-1952s1c1
Sequence:CCGGCAGAGAAATCCTATCTTGAAACTCGAGTTTCAAGATAGGATTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021486.2-1472s1c1
Sequence:CCGGCCAACCAAGATACTGAAATATCTCGAGATATTTCAGTATCTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021486.2-1423s1c1
Sequence:CCGGGAAGCCATATCGCTACATCTTCTCGAGAAGATGTAGCGATATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021486.2-596s1c1
Sequence:CCGGGAGACCAACTACATCAGGAAACTCGAGTTTCCTGATGTAGTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021486.2-1396s1c1
Sequence:CCGGCCCTCGGATAAATTATGCTTACTCGAGTAAGCATAATTTATCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks