EMAIL THIS PAGE TO A FRIEND

BCO2

beta-carotene oxygenase 2

130 Gene Product Result for
Synonyms: B-DIOX-II BCDO2
Gene ID:
Human(83875) Summary: This gene encodes an enzyme which oxidizes carotenoids such as beta-carotene during the biosynthesis of vitamin A. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(170752) beta-carotene oxygenase 2
Rat(315644) beta-carotene oxygenase 2
chicken(419792) beta-carotene oxygenase 2
cow(514135) beta-carotene oxygenase 2
domestic cat(101095765) beta-carotene oxygenase 2
dog(479437) beta-carotene oxygenase 2
sheep(100286796) beta-carotene oxygenase 2
domestic guinea pig(100716090) beta-carotene oxygenase 2
naked mole-rat(101704023) beta-carotene oxygenase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031938 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037290 Rosetta Predictions human pricing
NM_031938 Rosetta Predictions human pricing
NM_001127712 Rosetta Predictions rat pricing
NM_133217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308253 predicted 366
2 SASI_Hs01_00043520 predicted 1112
3 SASI_Hs01_00043521 predicted 552
4 SASI_Hs01_00043522 predicted 865
5 SASI_Hs01_00043523 predicted 358
6 SASI_Hs01_00043524 predicted 491
7 SASI_Hs01_00043525 predicted 542
8 SASI_Hs02_00308254 predicted 418
9 SASI_Hs01_00043527 predicted 1129
10 SASI_Hs01_00043528 predicted 843
11 SASI_Hs01_00043526 predicted 1046
12 SASI_Hs01_00043529 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359078 predicted 479
2 SASI_Hs01_00077968 predicted 1224
3 SASI_Hs01_00077969 predicted 667
4 SASI_Hs01_00077970 predicted 975
5 SASI_Hs01_00077971 predicted 466
6 SASI_Hs01_00077972 predicted 604
7 SASI_Hs01_00077973 predicted 651
8 SASI_Hs02_00359079 predicted 532
9 SASI_Hs01_00077975 predicted 1249
10 SASI_Hs01_00077976 predicted 953
11 SASI_Hs01_00077974 predicted 1131
12 SASI_Hs01_00077977 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254910 predicted 701
2 SASI_Rn02_00254911 predicted 1679
3 SASI_Rn02_00254912 predicted 757
4 SASI_Rn02_00254913 predicted 264
5 SASI_Rn02_00254914 predicted 321
6 SASI_Rn02_00254915 predicted 797
7 SASI_Rn02_00254916 predicted 423
8 SASI_Rn02_00254917 predicted 336
9 SASI_Rn02_00254918 predicted 1719
10 SASI_Rn02_00254919 predicted 1475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338419 predicted 249
2 SASI_Mm01_00137520 predicted 535
3 SASI_Mm01_00137521 predicted 756
4 SASI_Mm02_00338420 predicted 248
5 SASI_Mm01_00137523 predicted 379
6 SASI_Mm01_00137526 predicted 855
7 SASI_Mm01_00137527 predicted 476
8 SASI_Mm02_00338421 predicted 323
9 SASI_Mm01_00137528 predicted 1091
10 SASI_Mm02_00338422 predicted 1220
11 SASI_Mm01_00137519 predicted 854
12 SASI_Mm01_00137522 predicted 267
13 SASI_Mm01_00137524 predicted 1125
14 SASI_Mm01_00137525 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133217
BCO2 MISSION shRNA Bacterial Glycerol Stock
beta-carotene oxygenase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133217.1-1683s1c1
Sequence:CCGGGCTGTTGTAGTTTGGACCTGACTCGAGTCAGGTCCAAACTACAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133217.1-369s1c1
Sequence:CCGGGCCACCTACTATGACTGACAACTCGAGTTGTCAGTCATAGTAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133217.1-891s1c1
Sequence:CCGGCCCAGGAATGTACTACAGCATCTCGAGATGCTGTAGTACATTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133217.1-703s1c1
Sequence:CCGGCCTTCTTACTACCATAGCTTTCTCGAGAAAGCTATGGTAGTAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133217.1-702s1c1
Sequence:CCGGGCCTTCTTACTACCATAGCTTCTCGAGAAGCTATGGTAGTAAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133217
BCO2 MISSION shRNA shRNA Plasmid DNA
beta-carotene oxygenase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133217.1-1683s1c1
Sequence:CCGGGCTGTTGTAGTTTGGACCTGACTCGAGTCAGGTCCAAACTACAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133217.1-369s1c1
Sequence:CCGGGCCACCTACTATGACTGACAACTCGAGTTGTCAGTCATAGTAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133217.1-891s1c1
Sequence:CCGGCCCAGGAATGTACTACAGCATCTCGAGATGCTGTAGTACATTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133217.1-703s1c1
Sequence:CCGGCCTTCTTACTACCATAGCTTTCTCGAGAAAGCTATGGTAGTAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133217.1-702s1c1
Sequence:CCGGGCCTTCTTACTACCATAGCTTCTCGAGAAGCTATGGTAGTAAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133217
BCO2 MISSION shRNA Lentiviral Transduction Particles
beta-carotene oxygenase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133217.1-1683s1c1
Sequence:CCGGGCTGTTGTAGTTTGGACCTGACTCGAGTCAGGTCCAAACTACAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133217.1-369s1c1
Sequence:CCGGGCCACCTACTATGACTGACAACTCGAGTTGTCAGTCATAGTAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133217.1-891s1c1
Sequence:CCGGCCCAGGAATGTACTACAGCATCTCGAGATGCTGTAGTACATTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133217.1-703s1c1
Sequence:CCGGCCTTCTTACTACCATAGCTTTCTCGAGAAAGCTATGGTAGTAAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133217.1-702s1c1
Sequence:CCGGGCCTTCTTACTACCATAGCTTCTCGAGAAGCTATGGTAGTAAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031938
BCO2 MISSION shRNA Bacterial Glycerol Stock
beta-carotene oxygenase 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-790s1c1
Sequence:CCGGGCTTCTACAGAGAAAGGGAAACTCGAGTTTCCCTTTCTCTGTAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-1085s1c1
Sequence:CCGGGCTGTCAAGATAATGGAAGAACTCGAGTTCTTCCATTATCTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-484s1c1
Sequence:CCGGGCCATGACTGACAATACTAATCTCGAGATTAGTATTGTCAGTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-1585s1c1
Sequence:CCGGCCCAACCAGAATGAAAGCAATCTCGAGATTGCTTTCATTCTGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-335s1c1
Sequence:CCGGGCAAGTTTCTACAGAGTGATACTCGAGTATCACTCTGTAGAAACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-1564s21c1
Sequence:CCGGGGCTGTGGCTTTCGGCATTTACTCGAGTAAATGCCGAAAGCCACAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-750s21c1
Sequence:CCGGGGTAGATTGGAGCAAATTTATCTCGAGATAAATTTGCTCCAATCTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-1300s21c1
Sequence:CCGGGGGCTTGATCAGGTCCATAATCTCGAGATTATGGACCTGATCAAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-359s21c1
Sequence:CCGGATGGCTCTCTACTTCGAATTGCTCGAGCAATTCGAAGTAGAGAGCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-853s21c1
Sequence:CCGGGGTTTCTCCTATAAGGTTATTCTCGAGAATAACCTTATAGGAGAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031938
BCO2 MISSION shRNA shRNA Plasmid DNA
beta-carotene oxygenase 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-790s1c1
Sequence:CCGGGCTTCTACAGAGAAAGGGAAACTCGAGTTTCCCTTTCTCTGTAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-1085s1c1
Sequence:CCGGGCTGTCAAGATAATGGAAGAACTCGAGTTCTTCCATTATCTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-484s1c1
Sequence:CCGGGCCATGACTGACAATACTAATCTCGAGATTAGTATTGTCAGTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-1585s1c1
Sequence:CCGGCCCAACCAGAATGAAAGCAATCTCGAGATTGCTTTCATTCTGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-335s1c1
Sequence:CCGGGCAAGTTTCTACAGAGTGATACTCGAGTATCACTCTGTAGAAACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-1564s21c1
Sequence:CCGGGGCTGTGGCTTTCGGCATTTACTCGAGTAAATGCCGAAAGCCACAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-750s21c1
Sequence:CCGGGGTAGATTGGAGCAAATTTATCTCGAGATAAATTTGCTCCAATCTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-1300s21c1
Sequence:CCGGGGGCTTGATCAGGTCCATAATCTCGAGATTATGGACCTGATCAAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-359s21c1
Sequence:CCGGATGGCTCTCTACTTCGAATTGCTCGAGCAATTCGAAGTAGAGAGCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-853s21c1
Sequence:CCGGGGTTTCTCCTATAAGGTTATTCTCGAGAATAACCTTATAGGAGAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031938
BCO2 MISSION shRNA Lentiviral Transduction Particles
beta-carotene oxygenase 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-790s1c1
Sequence:CCGGGCTTCTACAGAGAAAGGGAAACTCGAGTTTCCCTTTCTCTGTAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-1085s1c1
Sequence:CCGGGCTGTCAAGATAATGGAAGAACTCGAGTTCTTCCATTATCTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-484s1c1
Sequence:CCGGGCCATGACTGACAATACTAATCTCGAGATTAGTATTGTCAGTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-1585s1c1
Sequence:CCGGCCCAACCAGAATGAAAGCAATCTCGAGATTGCTTTCATTCTGGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031938.2-335s1c1
Sequence:CCGGGCAAGTTTCTACAGAGTGATACTCGAGTATCACTCTGTAGAAACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-1564s21c1
Sequence:CCGGGGCTGTGGCTTTCGGCATTTACTCGAGTAAATGCCGAAAGCCACAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-750s21c1
Sequence:CCGGGGTAGATTGGAGCAAATTTATCTCGAGATAAATTTGCTCCAATCTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-1300s21c1
Sequence:CCGGGGGCTTGATCAGGTCCATAATCTCGAGATTATGGACCTGATCAAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-359s21c1
Sequence:CCGGATGGCTCTCTACTTCGAATTGCTCGAGCAATTCGAAGTAGAGAGCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031938.4-853s21c1
Sequence:CCGGGGTTTCTCCTATAAGGTTATTCTCGAGAATAACCTTATAGGAGAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)