EMAIL THIS PAGE TO A FRIEND

BCOR

BCL6 corepressor

246 Gene Product Result for
Synonyms: ANOP2 MAA2 MCOPS2
Gene ID:
Human(54880) Summary: The protein encoded by this gene was identified as an interacting corepressor of BCL6, a POZ/zinc finger transcription repressor that is required for germinal center formation and may influence apoptosis. This protein selectively interacts with the POZ domain of BCL6, but not with eight other POZ proteins. Specific class I and II histone deacetylases (HDACs) have been shown to interact with this protein, which suggests a possible link between the two classes of HDACs. Several transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene is found on chromosome Y.[provided by RefSeq, Jun 2010]
Mouse(71458) BCL6 interacting corepressor
Rat(317346) BCL6 co-repressor
Zebrafish(402921) BCL6 co-repressor
chicken(418574) BCL6 corepressor
dog(480880) BCL6 corepressor
domestic cat(101088726) BCL6 corepressor
cow(541088) BCL-6 interacting corepressor
cow(784529) BCL6 corepressor
Horse(100050335) BCL6 corepressor
naked mole-rat(101703837) BCL6 corepressor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017745 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU074271 MISSION® esiRNA esiRNA targeting mouse Bcor (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123383 Rosetta Predictions human pricing
NM_001123384 Rosetta Predictions human pricing
NM_001123385 Rosetta Predictions human pricing
NM_017745 Rosetta Predictions human pricing
NM_020926 Rosetta Predictions human pricing
XM_228716 Rosetta Predictions rat pricing
XR_009547 Rosetta Predictions rat pricing
NM_029510 Rosetta Predictions mouse pricing
NM_175044 Rosetta Predictions mouse pricing
NM_175045 Rosetta Predictions mouse pricing
NM_175046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327866 predicted 4357
2 SASI_Hs02_00327867 predicted 1792
3 SASI_Hs02_00327868 predicted 4743
4 SASI_Hs02_00327869 predicted 2948
5 SASI_Hs02_00327870 predicted 900
6 SASI_Hs02_00327871 predicted 2831
7 SASI_Hs02_00327872 predicted 5399
8 SASI_Hs02_00327873 predicted 5416
9 SASI_Hs02_00327874 predicted 2771
10 SASI_Hs02_00327875 predicted 2727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327876 predicted 4301
2 SASI_Hs02_00327877 predicted 1798
3 SASI_Hs02_00327878 predicted 4693
4 SASI_Hs02_00327879 predicted 2944
5 SASI_Hs02_00327880 predicted 902
6 SASI_Hs02_00327881 predicted 2837
7 SASI_Hs02_00327882 predicted 5348
8 SASI_Hs02_00327883 predicted 5365
9 SASI_Hs02_00327884 predicted 2773
10 SASI_Hs02_00327885 predicted 2734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327886 predicted 4389
2 SASI_Hs02_00327887 predicted 1727
3 SASI_Hs02_00327888 predicted 4772
4 SASI_Hs02_00327889 predicted 2870
5 SASI_Hs02_00327890 predicted 828
6 SASI_Hs02_00327891 predicted 2766
7 SASI_Hs02_00327892 predicted 5431
8 SASI_Hs02_00327893 predicted 5445
9 SASI_Hs02_00327894 predicted 2699
10 SASI_Hs02_00327895 predicted 2662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350547 predicted 4284
2 SASI_Hs01_00100862 predicted 1723
3 SASI_Hs02_00350548 predicted 4678
4 SASI_Hs02_00350549 predicted 2873
5 SASI_Hs01_00100864 predicted 827
6 SASI_Hs01_00100869 predicted 2765
7 SASI_Hs02_00350550 predicted 5330
8 SASI_Hs02_00350551 predicted 5341
9 SASI_Hs02_00350552 predicted 2701
10 SASI_Hs02_00350553 predicted 2660
11 SASI_Hs01_00100860 predicted 1710
12 SASI_Hs01_00100861 predicted 2863
13 SASI_Hs01_00100863 predicted 857
14 SASI_Hs01_00100865 predicted 1166
15 SASI_Hs01_00100866 predicted 1736
16 SASI_Hs01_00100867 predicted 512
17 SASI_Hs01_00100868 predicted 1984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042932 predicted 1705
2 SASI_Hs01_00042933 predicted 2859
3 SASI_Hs01_00042934 predicted 1685
4 SASI_Hs01_00042935 predicted 857
5 SASI_Hs01_00042936 predicted 789
6 SASI_Hs01_00042937 predicted 1162
7 SASI_Hs01_00042938 predicted 1732
8 SASI_Hs01_00042939 predicted 511
9 SASI_Hs01_00042940 predicted 1976
10 SASI_Hs01_00042941 predicted 2724
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00186106 predicted 554
2 SASI_Rn01_00186107 predicted 5589
3 SASI_Rn01_00186108 predicted 2926
4 SASI_Rn01_00186109 predicted 3154
5 SASI_Rn01_00186110 predicted 3978
6 SASI_Rn01_00186111 predicted 643
7 SASI_Rn01_00186112 predicted 4426
8 SASI_Rn01_00186113 predicted 4968
9 SASI_Rn01_00186114 predicted 3215
10 SASI_Rn01_00186115 predicted 1773
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420099 predicted 1851
2 SASI_Rn01_00150917 predicted 3589
3 SASI_Rn01_00150918 predicted 3826
4 SASI_Rn02_00420100 predicted 5335
5 SASI_Rn02_00420101 predicted 6216
6 SASI_Rn01_00150919 predicted 4593
7 SASI_Rn01_00150922 predicted 5579
8 SASI_Rn01_00150923 predicted 3884
9 SASI_Rn02_00420102 predicted 4144
10 SASI_Rn01_00150924 predicted 2442
11 SASI_Rn01_00150915 predicted 1227
12 SASI_Rn01_00150916 predicted 6206
13 SASI_Rn01_00150920 predicted 1322
14 SASI_Rn01_00150921 predicted 5053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075141 predicted 1557
2 SASI_Mm01_00075142 predicted 4983
3 SASI_Mm02_00335448 predicted 1728
4 SASI_Mm02_00335449 predicted 1399
5 SASI_Mm01_00075147 predicted 4766
6 SASI_Mm02_00335450 predicted 4996
7 SASI_Mm02_00335451 predicted 4926
8 SASI_Mm02_00335452 predicted 4644
9 SASI_Mm02_00335453 predicted 5001
10 SASI_Mm02_00335454 predicted 4774
11 SASI_Mm01_00075143 predicted 5177
12 SASI_Mm01_00075144 predicted 5409
13 SASI_Mm01_00075145 predicted 4526
14 SASI_Mm01_00075146 predicted 3779
15 SASI_Mm01_00075148 predicted 3021
16 SASI_Mm01_00075149 predicted 2507
17 SASI_Mm01_00075150 predicted 3151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047225 predicted 1552
2 SASI_Mm01_00047226 predicted 4927
3 SASI_Mm02_00345643 predicted 1730
4 SASI_Mm02_00345644 predicted 1400
5 SASI_Mm01_00047228 predicted 4706
6 SASI_Mm01_00047229 predicted 4941
7 SASI_Mm01_00047230 predicted 4878
8 SASI_Mm01_00047232 predicted 4594
9 SASI_Mm01_00047233 predicted 4948
10 SASI_Mm01_00047234 predicted 4726
11 SASI_Mm01_00047227 predicted 3308
12 SASI_Mm01_00047231 predicted 2500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099808 predicted 1739
2 SASI_Mm01_00099809 predicted 5068
3 SASI_Mm02_00345645 predicted 1918
4 SASI_Mm02_00345646 predicted 1584
5 SASI_Mm01_00099811 predicted 4847
6 SASI_Mm01_00099812 predicted 5086
7 SASI_Mm01_00099813 predicted 5016
8 SASI_Mm01_00099815 predicted 4733
9 SASI_Mm01_00099816 predicted 5086
10 SASI_Mm01_00099817 predicted 4860
11 SASI_Mm01_00099810 predicted 3550
12 SASI_Mm01_00099814 predicted 2692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148785 predicted 1559
2 SASI_Mm01_00148786 predicted 4832
3 SASI_Mm02_00345647 predicted 1729
4 SASI_Mm02_00345648 predicted 1401
5 SASI_Mm01_00148788 predicted 4609
6 SASI_Mm01_00148789 predicted 4843
7 SASI_Mm01_00148790 predicted 4772
8 SASI_Mm01_00148792 predicted 4489
9 SASI_Mm01_00148793 predicted 4844
10 SASI_Mm01_00148794 predicted 4617
11 SASI_Mm01_00148787 predicted 3308
12 SASI_Mm01_00148791 predicted 2501
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017745
VALIDATED
BCOR MISSION shRNA Bacterial Glycerol Stock
BCL6 corepressor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017745.5-3207s21c1
Sequence:CCGGACGTGGGTGACCGATTCAAATCTCGAGATTTGAATCGGTCACCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017745.5-6045s21c1
Sequence:CCGGCGCATCAAACCGGATTGTTTACTCGAGTAAACAATCCGGTTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_017745.5-2150s21c1
Sequence:CCGGAGCAACCCAGAACCGAGTTTCCTCGAGGAAACTCGGTTCTGGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017745.4-5179s1c1
Sequence:CCGGCCCGCATATTTCGCTGCAATTCTCGAGAATTGCAGCGAAATATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017745.4-878s1c1
Sequence:CCGGGCCAAATAAGTATTCACTGAACTCGAGTTCAGTGAATACTTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017745.4-2846s1c1
Sequence:CCGGCCACGAAACTTATACTTTCAACTCGAGTTGAAAGTATAAGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017745.4-2158s1c1
Sequence:CCGGGCTCTATATTTCTGTCTCCAACTCGAGTTGGAGACAGAAATATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017745
VALIDATED
BCOR MISSION shRNA shRNA Plasmid DNA
BCL6 corepressor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017745.5-3207s21c1
Sequence:CCGGACGTGGGTGACCGATTCAAATCTCGAGATTTGAATCGGTCACCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017745.5-6045s21c1
Sequence:CCGGCGCATCAAACCGGATTGTTTACTCGAGTAAACAATCCGGTTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_017745.5-2150s21c1
Sequence:CCGGAGCAACCCAGAACCGAGTTTCCTCGAGGAAACTCGGTTCTGGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017745.4-5179s1c1
Sequence:CCGGCCCGCATATTTCGCTGCAATTCTCGAGAATTGCAGCGAAATATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017745.4-878s1c1
Sequence:CCGGGCCAAATAAGTATTCACTGAACTCGAGTTCAGTGAATACTTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017745.4-2846s1c1
Sequence:CCGGCCACGAAACTTATACTTTCAACTCGAGTTGAAAGTATAAGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017745.4-2158s1c1
Sequence:CCGGGCTCTATATTTCTGTCTCCAACTCGAGTTGGAGACAGAAATATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017745
VALIDATED
BCOR MISSION shRNA Lentiviral Transduction Particles
BCL6 corepressor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017745.5-3207s21c1
Sequence:CCGGACGTGGGTGACCGATTCAAATCTCGAGATTTGAATCGGTCACCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017745.5-6045s21c1
Sequence:CCGGCGCATCAAACCGGATTGTTTACTCGAGTAAACAATCCGGTTTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_017745.5-2150s21c1
Sequence:CCGGAGCAACCCAGAACCGAGTTTCCTCGAGGAAACTCGGTTCTGGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017745.4-5179s1c1
Sequence:CCGGCCCGCATATTTCGCTGCAATTCTCGAGAATTGCAGCGAAATATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017745.4-878s1c1
Sequence:CCGGGCCAAATAAGTATTCACTGAACTCGAGTTCAGTGAATACTTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017745.4-2846s1c1
Sequence:CCGGCCACGAAACTTATACTTTCAACTCGAGTTGAAAGTATAAGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017745.4-2158s1c1
Sequence:CCGGGCTCTATATTTCTGTCTCCAACTCGAGTTGGAGACAGAAATATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029510
VALIDATED
BCOR MISSION shRNA Bacterial Glycerol Stock
BCL6 corepressor
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000081963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029510.1-5388s1c1
Sequence:CCGGCCCACTGTGTACAGTGTGTTACTCGAGTAACACACTGTACACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029510.1-5132s1c1
Sequence:CCGGCCCGGATATTCCGTAGCAATTCTCGAGAATTGCTACGGAATATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029510.1-2224s1c1
Sequence:CCGGCCAGAATTTGTGACCTACCAACTCGAGTTGGTAGGTCACAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029510.1-4725s1c1
Sequence:CCGGCCACTTAGAAATTGTACGATTCTCGAGAATCGTACAATTTCTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029510
VALIDATED
BCOR MISSION shRNA shRNA Plasmid DNA
BCL6 corepressor
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000081963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029510.1-5388s1c1
Sequence:CCGGCCCACTGTGTACAGTGTGTTACTCGAGTAACACACTGTACACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029510.1-5132s1c1
Sequence:CCGGCCCGGATATTCCGTAGCAATTCTCGAGAATTGCTACGGAATATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029510.1-2224s1c1
Sequence:CCGGCCAGAATTTGTGACCTACCAACTCGAGTTGGTAGGTCACAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029510.1-4725s1c1
Sequence:CCGGCCACTTAGAAATTGTACGATTCTCGAGAATCGTACAATTTCTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029510
VALIDATED
BCOR MISSION shRNA Lentiviral Transduction Particles
BCL6 corepressor
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000081963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029510.1-5388s1c1
Sequence:CCGGCCCACTGTGTACAGTGTGTTACTCGAGTAACACACTGTACACAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029510.1-5132s1c1
Sequence:CCGGCCCGGATATTCCGTAGCAATTCTCGAGAATTGCTACGGAATATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029510.1-2224s1c1
Sequence:CCGGCCAGAATTTGTGACCTACCAACTCGAGTTGGTAGGTCACAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029510.1-4725s1c1
Sequence:CCGGCCACTTAGAAATTGTACGATTCTCGAGAATCGTACAATTTCTAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks