EMAIL THIS PAGE TO A FRIEND

BCORL1

BCL6 corepressor-like 1

138 Gene Product Result for
Synonyms: BCoR-L1 CXorf10
Gene ID:
Human(63035) Summary: The protein encoded by this gene is a transcriptional corepressor that is found tethered to promoter regions by DNA-binding proteins. The encoded protein can interact with several different class II histone deacetylases to repress transcription. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Mouse(320376) BCL6 co-repressor-like 1
Rat(302810) BCL6 co-repressor-like 1
domestic guinea pig(100735147) BCL6 corepressor-like 1
naked mole-rat(101696450) BCL6 corepressor-like 1
sheep(101121071) BCL6 corepressor-like 1
chicken(428687) BCL6 corepressor-like 1
cow(540023) BCL6 corepressor-like 1
domestic cat(101081199) BCL6 corepressor-like 1
dog(481047) BCL6 corepressor-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021946 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021946 Rosetta Predictions human pricing
XM_001059711 Rosetta Predictions rat pricing
XM_217627 Rosetta Predictions rat pricing
NM_178782 Rosetta Predictions mouse pricing
XM_979298 Rosetta Predictions mouse pricing
XM_979335 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129606 predicted 1752
2 SASI_Hs01_00129607 predicted 2514
3 SASI_Hs01_00129608 predicted 2166
4 SASI_Hs01_00129609 predicted 3443
5 SASI_Hs01_00129611 predicted 3806
6 SASI_Hs01_00129612 predicted 1661
7 SASI_Hs01_00129613 predicted 3737
8 SASI_Hs01_00129614 predicted 4367
9 SASI_Hs01_00129615 predicted 4790
10 SASI_Hs02_00355268 predicted 2850
11 SASI_Hs01_00129610 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294038 predicted 242
2 SASI_Rn02_00294039 predicted 4255
3 SASI_Rn02_00294040 predicted 2294
4 SASI_Rn02_00294041 predicted 459
5 SASI_Rn02_00294042 predicted 2891
6 SASI_Rn02_00294043 predicted 3824
7 SASI_Rn02_00294044 predicted 5392
8 SASI_Rn02_00294045 predicted 3807
9 SASI_Rn02_00294046 predicted 727
10 SASI_Rn02_00294047 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377265 predicted 4092
2 SASI_Rn02_00377266 predicted 2124
3 SASI_Rn02_00377267 predicted 298
4 SASI_Rn02_00377268 predicted 2723
5 SASI_Rn02_00377269 predicted 3658
6 SASI_Rn02_00377270 predicted 5230
7 SASI_Rn02_00377271 predicted 3645
8 SASI_Rn02_00377272 predicted 3266
9 SASI_Rn02_00377273 predicted 564
10 SASI_Rn02_00377274 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349361 predicted 4171
2 SASI_Mm02_00349362 predicted 668
3 SASI_Mm02_00349363 predicted 2952
4 SASI_Mm02_00349364 predicted 331
5 SASI_Mm02_00349365 predicted 4321
6 SASI_Mm02_00349366 predicted 2359
7 SASI_Mm02_00349367 predicted 4761
8 SASI_Mm02_00349368 predicted 540
9 SASI_Mm02_00349369 predicted 4616
10 SASI_Mm02_00349370 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284098 predicted 4175
2 SASI_Mm01_00284099 predicted 678
3 SASI_Mm01_00284100 predicted 2956
4 SASI_Mm01_00284101 predicted 1736
5 SASI_Mm01_00284102 predicted 328
6 SASI_Mm01_00284103 predicted 4327
7 SASI_Mm01_00284104 predicted 2362
8 SASI_Mm01_00284105 predicted 552
9 SASI_Mm01_00284106 predicted 816
10 SASI_Mm01_00284107 predicted 1800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238512 predicted 4094
2 SASI_Mm01_00238513 predicted 592
3 SASI_Mm01_00238514 predicted 2880
4 SASI_Mm01_00238515 predicted 1649
5 SASI_Mm01_00238516 predicted 243
6 SASI_Mm01_00238517 predicted 4232
7 SASI_Mm01_00238518 predicted 2276
8 SASI_Mm01_00238519 predicted 466
9 SASI_Mm01_00238520 predicted 732
10 SASI_Mm01_00238521 predicted 1709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021946
BCORL1 MISSION shRNA Bacterial Glycerol Stock
BCL6 corepressor-like 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000033474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021946.2-5372s1c1
Sequence:CCGGCGCCTTATCAATGCCAGCATTCTCGAGAATGCTGGCATTGATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021946.2-5046s1c1
Sequence:CCGGGCACTTTGAAATCACCACCATCTCGAGATGGTGGTGATTTCAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021946
BCORL1 MISSION shRNA shRNA Plasmid DNA
BCL6 corepressor-like 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000033474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021946.2-5372s1c1
Sequence:CCGGCGCCTTATCAATGCCAGCATTCTCGAGAATGCTGGCATTGATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021946.2-5046s1c1
Sequence:CCGGGCACTTTGAAATCACCACCATCTCGAGATGGTGGTGATTTCAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021946
BCORL1 MISSION shRNA Lentiviral Transduction Particles
BCL6 corepressor-like 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000033474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021946.2-5372s1c1
Sequence:CCGGCGCCTTATCAATGCCAGCATTCTCGAGAATGCTGGCATTGATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021946.2-5046s1c1
Sequence:CCGGGCACTTTGAAATCACCACCATCTCGAGATGGTGGTGATTTCAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178782
BCORL1 MISSION shRNA Bacterial Glycerol Stock
BCL6 corepressor-like 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000085731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178782.3-1850s1c1
Sequence:CCGGGCCACTCTAAGGAACTCATTTCTCGAGAAATGAGTTCCTTAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178782.3-3523s1c1
Sequence:CCGGGTGGTCAATGACAACCTAGAACTCGAGTTCTAGGTTGTCATTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178782.3-1139s1c1
Sequence:CCGGGCACAGTGAAATCCCGTTATACTCGAGTATAACGGGATTTCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178782.3-4287s1c1
Sequence:CCGGGCCTTATCAATGCCAGCATTACTCGAGTAATGCTGGCATTGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178782
BCORL1 MISSION shRNA shRNA Plasmid DNA
BCL6 corepressor-like 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000085731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178782.3-1850s1c1
Sequence:CCGGGCCACTCTAAGGAACTCATTTCTCGAGAAATGAGTTCCTTAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178782.3-3523s1c1
Sequence:CCGGGTGGTCAATGACAACCTAGAACTCGAGTTCTAGGTTGTCATTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178782.3-1139s1c1
Sequence:CCGGGCACAGTGAAATCCCGTTATACTCGAGTATAACGGGATTTCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178782.3-4287s1c1
Sequence:CCGGGCCTTATCAATGCCAGCATTACTCGAGTAATGCTGGCATTGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178782
BCORL1 MISSION shRNA Lentiviral Transduction Particles
BCL6 corepressor-like 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000085731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178782.3-1850s1c1
Sequence:CCGGGCCACTCTAAGGAACTCATTTCTCGAGAAATGAGTTCCTTAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178782.3-3523s1c1
Sequence:CCGGGTGGTCAATGACAACCTAGAACTCGAGTTCTAGGTTGTCATTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178782.3-1139s1c1
Sequence:CCGGGCACAGTGAAATCCCGTTATACTCGAGTATAACGGGATTTCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178782.3-4287s1c1
Sequence:CCGGGCCTTATCAATGCCAGCATTACTCGAGTAATGCTGGCATTGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks