EMAIL THIS PAGE TO A FRIEND

BCORP1

BCL6 corepressor pseudogene 1

10 Gene Product Result for
Synonyms: BCORL2
Species: Human BCORP1(286554)
UniProtKB ID: Q8N888
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173700 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001173413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001173413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001173413 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002923 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00377299 predicted 2657
2 SASI_Hs02_00377300 predicted 2217
3 SASI_Hs02_00377301 predicted 1165
4 SASI_Hs02_00377302 predicted 2506
5 SASI_Hs02_00377303 predicted 1355
6 SASI_Hs02_00377304 predicted 856
7 SASI_Hs02_00377305 predicted 442
8 SASI_Hs02_00377306 predicted 770
9 SASI_Hs02_00377307 predicted 2452
10 SASI_Hs02_00377308 predicted 2428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173700
BCORP1 MISSION shRNA Bacterial Glycerol Stock
BCL6 corepressor pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-1056s1c1
Sequence:CCGGGCAAGATACCTCTTGGCACTTCTCGAGAAGTGCCAAGAGGTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-1034s1c1
Sequence:CCGGTGCTACGTTGAGAATGCTGATCTCGAGATCAGCATTCTCAACGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-755s1c1
Sequence:CCGGCCTCCACCGAAGAATAAGGTTCTCGAGAACCTTATTCTTCGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-939s1c1
Sequence:CCGGCCAATAACAGTGAGAAGCCATCTCGAGATGGCTTCTCACTGTTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-836s1c1
Sequence:CCGGCTGCCTGATAAGCAGCAGAAACTCGAGTTTCTGCTGCTTATCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173700
BCORP1 MISSION shRNA shRNA Plasmid DNA
BCL6 corepressor pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-1056s1c1
Sequence:CCGGGCAAGATACCTCTTGGCACTTCTCGAGAAGTGCCAAGAGGTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-1034s1c1
Sequence:CCGGTGCTACGTTGAGAATGCTGATCTCGAGATCAGCATTCTCAACGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-755s1c1
Sequence:CCGGCCTCCACCGAAGAATAAGGTTCTCGAGAACCTTATTCTTCGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-939s1c1
Sequence:CCGGCCAATAACAGTGAGAAGCCATCTCGAGATGGCTTCTCACTGTTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-836s1c1
Sequence:CCGGCTGCCTGATAAGCAGCAGAAACTCGAGTTTCTGCTGCTTATCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173700
BCORP1 MISSION shRNA Lentiviral Transduction Particles
BCL6 corepressor pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-1056s1c1
Sequence:CCGGGCAAGATACCTCTTGGCACTTCTCGAGAAGTGCCAAGAGGTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-1034s1c1
Sequence:CCGGTGCTACGTTGAGAATGCTGATCTCGAGATCAGCATTCTCAACGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-755s1c1
Sequence:CCGGCCTCCACCGAAGAATAAGGTTCTCGAGAACCTTATTCTTCGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-939s1c1
Sequence:CCGGCCAATAACAGTGAGAAGCCATCTCGAGATGGCTTCTCACTGTTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173700.1-836s1c1
Sequence:CCGGCTGCCTGATAAGCAGCAGAAACTCGAGTTTCTGCTGCTTATCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001173413
BCORP1 MISSION shRNA Bacterial Glycerol Stock
BCL6 corepressor pseudogene 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000420956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001173413.1-899s21c1
Sequence:CCGGCTCAAGGATGTAAAGCCTTTCCTCGAGGAAAGGCTTTACATCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173413.1-455s21c1
Sequence:CCGGGAAGTTGCCAGAGGACTCTTTCTCGAGAAAGAGTCCTCTGGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173413.1-359s21c1
Sequence:CCGGCCAGGTAGCTATGGATGTGATCTCGAGATCACATCCATAGCTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001173413
BCORP1 MISSION shRNA shRNA Plasmid DNA
BCL6 corepressor pseudogene 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000420956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001173413.1-899s21c1
Sequence:CCGGCTCAAGGATGTAAAGCCTTTCCTCGAGGAAAGGCTTTACATCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173413.1-455s21c1
Sequence:CCGGGAAGTTGCCAGAGGACTCTTTCTCGAGAAAGAGTCCTCTGGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173413.1-359s21c1
Sequence:CCGGCCAGGTAGCTATGGATGTGATCTCGAGATCACATCCATAGCTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001173413
BCORP1 MISSION shRNA Lentiviral Transduction Particles
BCL6 corepressor pseudogene 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000420956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001173413.1-899s21c1
Sequence:CCGGCTCAAGGATGTAAAGCCTTTCCTCGAGGAAAGGCTTTACATCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173413.1-455s21c1
Sequence:CCGGGAAGTTGCCAGAGGACTCTTTCTCGAGAAAGAGTCCTCTGGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001173413.1-359s21c1
Sequence:CCGGCCAGGTAGCTATGGATGTGATCTCGAGATCACATCCATAGCTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks